ID: 1159702845

View in Genome Browser
Species Human (GRCh38)
Location 18:71650858-71650880
Sequence TGGGTGCCTTCCCAGCGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702845_1159702857 19 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702845_1159702854 12 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702854 18:71650893-71650915 GCCTGAACAGAATATAAAGGTGG No data
1159702845_1159702853 9 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702845_1159702856 15 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702856 18:71650896-71650918 TGAACAGAATATAAAGGTGGAGG No data
1159702845_1159702848 -10 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702848 18:71650871-71650893 AAGGCACCCAAATCCCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702845 Original CRISPR TGGGTGCCTTCCCAGCGGTG AGG (reversed) Intergenic
No off target data available for this crispr