ID: 1159702847

View in Genome Browser
Species Human (GRCh38)
Location 18:71650870-71650892
Sequence GAAGGCACCCAAATCCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702844_1159702847 -7 Left 1159702844 18:71650854-71650876 CCATCCTCACCGCTGGGAAGGCA No data
Right 1159702847 18:71650870-71650892 GAAGGCACCCAAATCCCTTTAGG No data
1159702839_1159702847 30 Left 1159702839 18:71650817-71650839 CCTGAGCATGCGAGTCAGTAGAC No data
Right 1159702847 18:71650870-71650892 GAAGGCACCCAAATCCCTTTAGG No data
1159702843_1159702847 -6 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702847 18:71650870-71650892 GAAGGCACCCAAATCCCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702847 Original CRISPR GAAGGCACCCAAATCCCTTT AGG Intergenic
No off target data available for this crispr