ID: 1159702849

View in Genome Browser
Species Human (GRCh38)
Location 18:71650877-71650899
Sequence TTCAGGCCCTAAAGGGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702849_1159702857 0 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702849_1159702853 -10 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702849_1159702856 -4 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702856 18:71650896-71650918 TGAACAGAATATAAAGGTGGAGG No data
1159702849_1159702854 -7 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702854 18:71650893-71650915 GCCTGAACAGAATATAAAGGTGG No data
1159702849_1159702858 29 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702858 18:71650929-71650951 TTTCTCTTTGTCTTCTAAGCTGG No data
1159702849_1159702859 30 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702849 Original CRISPR TTCAGGCCCTAAAGGGATTT GGG (reversed) Intergenic
No off target data available for this crispr