ID: 1159702852

View in Genome Browser
Species Human (GRCh38)
Location 18:71650885-71650907
Sequence ATATTCTGTTCAGGCCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702852_1159702860 23 Left 1159702852 18:71650885-71650907 CCTTTAGGGCCTGAACAGAATAT No data
Right 1159702860 18:71650931-71650953 TCTCTTTGTCTTCTAAGCTGGGG No data
1159702852_1159702857 -8 Left 1159702852 18:71650885-71650907 CCTTTAGGGCCTGAACAGAATAT No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702852_1159702859 22 Left 1159702852 18:71650885-71650907 CCTTTAGGGCCTGAACAGAATAT No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data
1159702852_1159702858 21 Left 1159702852 18:71650885-71650907 CCTTTAGGGCCTGAACAGAATAT No data
Right 1159702858 18:71650929-71650951 TTTCTCTTTGTCTTCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702852 Original CRISPR ATATTCTGTTCAGGCCCTAA AGG (reversed) Intergenic
No off target data available for this crispr