ID: 1159702853

View in Genome Browser
Species Human (GRCh38)
Location 18:71650890-71650912
Sequence AGGGCCTGAACAGAATATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702846_1159702853 4 Left 1159702846 18:71650863-71650885 CCGCTGGGAAGGCACCCAAATCC No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702843_1159702853 14 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702845_1159702853 9 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702844_1159702853 13 Left 1159702844 18:71650854-71650876 CCATCCTCACCGCTGGGAAGGCA No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data
1159702849_1159702853 -10 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702853 18:71650890-71650912 AGGGCCTGAACAGAATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702853 Original CRISPR AGGGCCTGAACAGAATATAA AGG Intergenic
No off target data available for this crispr