ID: 1159702857

View in Genome Browser
Species Human (GRCh38)
Location 18:71650900-71650922
Sequence CAGAATATAAAGGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702846_1159702857 14 Left 1159702846 18:71650863-71650885 CCGCTGGGAAGGCACCCAAATCC No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702852_1159702857 -8 Left 1159702852 18:71650885-71650907 CCTTTAGGGCCTGAACAGAATAT No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702851_1159702857 -7 Left 1159702851 18:71650884-71650906 CCCTTTAGGGCCTGAACAGAATA No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702850_1159702857 -1 Left 1159702850 18:71650878-71650900 CCAAATCCCTTTAGGGCCTGAAC No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702843_1159702857 24 Left 1159702843 18:71650853-71650875 CCCATCCTCACCGCTGGGAAGGC No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702845_1159702857 19 Left 1159702845 18:71650858-71650880 CCTCACCGCTGGGAAGGCACCCA No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702849_1159702857 0 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data
1159702844_1159702857 23 Left 1159702844 18:71650854-71650876 CCATCCTCACCGCTGGGAAGGCA No data
Right 1159702857 18:71650900-71650922 CAGAATATAAAGGTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702857 Original CRISPR CAGAATATAAAGGTGGAGGA AGG Intergenic
No off target data available for this crispr