ID: 1159702859

View in Genome Browser
Species Human (GRCh38)
Location 18:71650930-71650952
Sequence TTCTCTTTGTCTTCTAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159702855_1159702859 13 Left 1159702855 18:71650894-71650916 CCTGAACAGAATATAAAGGTGGA No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data
1159702851_1159702859 23 Left 1159702851 18:71650884-71650906 CCCTTTAGGGCCTGAACAGAATA No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data
1159702849_1159702859 30 Left 1159702849 18:71650877-71650899 CCCAAATCCCTTTAGGGCCTGAA No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data
1159702850_1159702859 29 Left 1159702850 18:71650878-71650900 CCAAATCCCTTTAGGGCCTGAAC No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data
1159702852_1159702859 22 Left 1159702852 18:71650885-71650907 CCTTTAGGGCCTGAACAGAATAT No data
Right 1159702859 18:71650930-71650952 TTCTCTTTGTCTTCTAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159702859 Original CRISPR TTCTCTTTGTCTTCTAAGCT GGG Intergenic
No off target data available for this crispr