ID: 1159704873

View in Genome Browser
Species Human (GRCh38)
Location 18:71674625-71674647
Sequence GTCTTTTCTAGGCCTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159704873_1159704876 -2 Left 1159704873 18:71674625-71674647 CCATGGGCAGGCCTAGAAAAGAC No data
Right 1159704876 18:71674646-71674668 ACACCATAAGTTCTTGCTCTGGG No data
1159704873_1159704879 15 Left 1159704873 18:71674625-71674647 CCATGGGCAGGCCTAGAAAAGAC No data
Right 1159704879 18:71674663-71674685 TCTGGGTCATGGATTCTAACAGG No data
1159704873_1159704878 4 Left 1159704873 18:71674625-71674647 CCATGGGCAGGCCTAGAAAAGAC No data
Right 1159704878 18:71674652-71674674 TAAGTTCTTGCTCTGGGTCATGG No data
1159704873_1159704875 -3 Left 1159704873 18:71674625-71674647 CCATGGGCAGGCCTAGAAAAGAC No data
Right 1159704875 18:71674645-71674667 GACACCATAAGTTCTTGCTCTGG No data
1159704873_1159704880 21 Left 1159704873 18:71674625-71674647 CCATGGGCAGGCCTAGAAAAGAC No data
Right 1159704880 18:71674669-71674691 TCATGGATTCTAACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159704873 Original CRISPR GTCTTTTCTAGGCCTGCCCA TGG (reversed) Intergenic
No off target data available for this crispr