ID: 1159708003

View in Genome Browser
Species Human (GRCh38)
Location 18:71717424-71717446
Sequence GGCTGAGCTTGGGCAACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159708003_1159708007 -7 Left 1159708003 18:71717424-71717446 CCACAAGTTGCCCAAGCTCAGCC No data
Right 1159708007 18:71717440-71717462 CTCAGCCAGTGGTTGATCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159708003 Original CRISPR GGCTGAGCTTGGGCAACTTG TGG (reversed) Intergenic
No off target data available for this crispr