ID: 1159708007

View in Genome Browser
Species Human (GRCh38)
Location 18:71717440-71717462
Sequence CTCAGCCAGTGGTTGATCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159708002_1159708007 -6 Left 1159708002 18:71717423-71717445 CCCACAAGTTGCCCAAGCTCAGC No data
Right 1159708007 18:71717440-71717462 CTCAGCCAGTGGTTGATCCGAGG No data
1159708003_1159708007 -7 Left 1159708003 18:71717424-71717446 CCACAAGTTGCCCAAGCTCAGCC No data
Right 1159708007 18:71717440-71717462 CTCAGCCAGTGGTTGATCCGAGG No data
1159708001_1159708007 2 Left 1159708001 18:71717415-71717437 CCTAGTTTCCCACAAGTTGCCCA No data
Right 1159708007 18:71717440-71717462 CTCAGCCAGTGGTTGATCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159708007 Original CRISPR CTCAGCCAGTGGTTGATCCG AGG Intergenic
No off target data available for this crispr