ID: 1159711301

View in Genome Browser
Species Human (GRCh38)
Location 18:71764131-71764153
Sequence GACAACTCTTGGTTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 1, 2: 41, 3: 211, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159711301 Original CRISPR GACAACTCTTGGTTTGTTAC TGG Intronic
900434961 1:2625612-2625634 GACAGCTCTTGGCCCGTTACTGG + Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
904179491 1:28655935-28655957 GACAGCTCTTGGCCTATTACTGG - Intergenic
904335935 1:29798022-29798044 GACAGCTCTTGGCCTATTACTGG + Intergenic
904688676 1:32277518-32277540 CACCCCTCTTGGTCTGTTACTGG + Intronic
905729805 1:40289377-40289399 AATAACTTTTGGTTTGCTACTGG - Intronic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
907595515 1:55716122-55716144 GACAACTCTTAGTCTGTCCCTGG + Intergenic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
908046105 1:60170683-60170705 GACAACTCATTGTCTCTTACAGG + Intergenic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910008078 1:82424775-82424797 CTCAACTCTATGTTTGTTACAGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911019191 1:93369734-93369756 CACAACAGTAGGTTTGTTACTGG - Intergenic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911364800 1:96925073-96925095 TACTATTCTTGGTTTGTTACTGG + Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
911981897 1:104579226-104579248 GAAAACTCTTGGCCTGTTATTGG - Intergenic
912050675 1:105524911-105524933 GATAACTCTTGGCCTATTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912212255 1:107568930-107568952 GACAGCTCTTGGATTGCTACTGG + Intergenic
912252026 1:108021352-108021374 GACAGCTCTTGGGTTGTTACTGG - Intergenic
912618024 1:111125909-111125931 CACAACTCTTTGTTCCTTACTGG + Intronic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
915667667 1:157459607-157459629 GACAGCTCTTGGTCTGTTGCGGG - Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
916365965 1:164028051-164028073 AACAGCTCTTGGTCTGCTACTGG - Intergenic
916669579 1:167002119-167002141 GACCACACTGGGTTTGTTCCTGG - Intronic
917217211 1:172690877-172690899 GGCAGCTCTTGGTCTGTTACTGG - Intergenic
917276498 1:173337230-173337252 AACAACTCTTGGCCTGCTACTGG + Intergenic
917353620 1:174103794-174103816 AGCAACTCTTGTTTTGATACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918688000 1:187443814-187443836 GAAAAAGCTTGGGTTGTTACTGG + Intergenic
918774495 1:188610783-188610805 GACATCTCTTTGCCTGTTACTGG + Intergenic
918815080 1:189171264-189171286 ACCAGCTCTTGGTCTGTTACTGG + Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
920197433 1:204238402-204238424 GACACCTGTTGGTCTGTTACTGG + Intronic
920761246 1:208785452-208785474 GACAACTCTTGGTTAAGTTCAGG + Intergenic
921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG + Intergenic
922246653 1:223805658-223805680 GACAATTGTTGGTTTGTCATGGG - Intronic
923192599 1:231634191-231634213 GTCATCTCTTGGTTTGTGAGTGG + Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924477396 1:244394165-244394187 GACAACTCTTGGCCTACTACTGG - Intergenic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924946821 1:248852045-248852067 CACAACTTTTGGTCTGTTCCGGG + Intronic
1063010837 10:2020267-2020289 GACATCTGATGGTTTGTGACAGG - Intergenic
1064545686 10:16448099-16448121 GACAGCTCTTGGCCAGTTACTGG - Intronic
1064823817 10:19372235-19372257 AACAACTCTTGGATTGTTGAGGG + Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1065656188 10:27952794-27952816 GAAAACTATTGGTATGTTACTGG + Intronic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068062882 10:52091314-52091336 GAAGACTCTTGGTTTTTTAAAGG + Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1070120340 10:73570099-73570121 CTGAATTCTTGGTTTGTTACAGG - Intronic
1070437978 10:76412257-76412279 GACAACTCAAGATTTGTTCCAGG - Intronic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1071947084 10:90657695-90657717 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1072209256 10:93231642-93231664 GACAGATCTTGGCTTGTTACTGG - Intergenic
1073308640 10:102523523-102523545 GACAAAGCTTGGTTGGTTAGAGG + Intronic
1073557351 10:104465936-104465958 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073995871 10:109314681-109314703 GATAGCTCTTGGCTTATTACTGG - Intergenic
1075237565 10:120744808-120744830 AAAAAATCTTGGTTTGTTAAAGG + Intergenic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076927414 10:133499190-133499212 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG + Intergenic
1081065459 11:38534866-38534888 GGCAGCTCTTGGCTTGTTATTGG - Intergenic
1081072778 11:38631131-38631153 GACATTTCTTGGCCTGTTACTGG + Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1083835313 11:65262703-65262725 CACATCTGTTGCTTTGTTACCGG - Intronic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086254636 11:84861263-84861285 GAAAAATCTTGGTTTGTTCACGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087157497 11:94919514-94919536 GGCAACTCTTGGTGGGTTTCTGG - Intergenic
1087968153 11:104444836-104444858 GACAACTCTCTGATTATTACAGG - Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090221614 11:125031575-125031597 GACAGCTCTTAGCCTGTTACTGG - Intronic
1090753985 11:129772576-129772598 GACAATTCTTGGTCTGCTACTGG - Intergenic
1091170068 11:133512183-133512205 GACAAATCCTGATTTGTTGCTGG - Intronic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1092656052 12:10686559-10686581 AACAACTCTTGGTGTGCTACTGG - Intergenic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1093645730 12:21583681-21583703 GAAAGCTCTTGGCCTGTTACTGG + Intronic
1094102532 12:26779273-26779295 GACAGCTCTTGGTCTGGTACTGG + Intronic
1095121505 12:38424833-38424855 GGCAACTCTTGGCCTGTGACAGG - Intergenic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095818059 12:46446600-46446622 GAAAGCCCTTGGTTTGTTAAGGG + Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1096288713 12:50322971-50322993 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099508562 12:83507198-83507220 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1099689781 12:85938048-85938070 GACAGCTCTTTGTCTGTTACTGG + Intergenic
1100083304 12:90878223-90878245 GACAGCTCTTTGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1102211234 12:111128678-111128700 AACAGCTCTTGGTTTGCTACTGG - Intronic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1104182048 12:126391076-126391098 GGCCACTCTTGCTTTATTACTGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1106756453 13:32827155-32827177 GAATACTCTTGGTTTGAAACTGG + Intergenic
1107092706 13:36499561-36499583 GATAACTCTTGGTTTTTCAGTGG - Intergenic
1107429993 13:40332026-40332048 GGCAACTCTTGGTGGGTTCCTGG + Intergenic
1107983575 13:45755961-45755983 GACAGCTCTTGGCCTATTACTGG - Intergenic
1108302433 13:49091974-49091996 GACAGCTCTTGGCCCGTTACTGG - Intronic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111317503 13:86581812-86581834 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
1112231126 13:97590153-97590175 GATAGCTCTTGGTTTGTTACTGG - Intergenic
1112249926 13:97770267-97770289 GACAGCTCTTGGGCTGTTACTGG - Intergenic
1113803312 13:113097395-113097417 GAAAACTATTTTTTTGTTACCGG + Intronic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1115059717 14:29173905-29173927 GACAGCTCTTGGCTTGTAACTGG + Intergenic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1115143400 14:30199398-30199420 GGCAACTCTTGGCCTGCTACTGG + Intergenic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116308043 14:43283436-43283458 GACAGCTCTTGGCCTGCTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118122433 14:62860159-62860181 GACAGCTCTTAGCCTGTTACTGG - Intronic
1118385501 14:65252534-65252556 GACAGCTCTTGGTCTGCTACTGG - Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119059696 14:71462179-71462201 GACAGCTCTTTGTCTGTTACTGG - Intronic
1119107563 14:71938828-71938850 GACAGCTCTTGGCCTATTACTGG - Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1120970290 14:90201452-90201474 GTCAGCTCTTGCTTTGTTCCAGG + Intergenic
1125143343 15:36436292-36436314 GACAACTTTTGATTTCCTACGGG - Intergenic
1125176120 15:36823790-36823812 GATAACTCTTGTTTTTTTAGGGG + Intergenic
1126072947 15:44882099-44882121 GAATACTCTTGGTTTGTGACTGG - Intergenic
1126085305 15:45005549-45005571 GAATACTCTTGGTTTGTGACTGG + Intergenic
1126283611 15:46986288-46986310 AACAACTCTTGGCCTGTTATTGG + Intergenic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1128194253 15:65736627-65736649 GACAAATGCTGGTTTCTTACAGG - Intronic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1131899437 15:97071872-97071894 GACAAAGCGTGATTTGTTACTGG + Intergenic
1135626004 16:23995507-23995529 GACAGCTCTTGGCCTGCTACCGG + Intronic
1135652160 16:24215802-24215824 TACAAATCTAGGTTTGTTACTGG + Exonic
1138718902 16:59055573-59055595 GTCAAATCTAGGTTTGTTGCTGG + Intergenic
1138998931 16:62484987-62485009 CACAACTCTTGGTGAGTTCCTGG - Intergenic
1139341300 16:66269880-66269902 GAGGACTCTTGGTTTGATTCCGG - Intergenic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1144745854 17:17613771-17613793 GCCTGCTCCTGGTTTGTTACAGG - Intergenic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146850934 17:36221051-36221073 GACAGCTCTTAGCCTGTTACTGG + Intronic
1151154227 17:72113623-72113645 GCCAACTCTTGGGTTATTATAGG - Intergenic
1151224163 17:72636362-72636384 GCCAACTCTTGGTTTCTTCAAGG - Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1153791323 18:8582374-8582396 AACAACTCCTGGTGTGTTCCTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155940708 18:31799605-31799627 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1155976519 18:32137708-32137730 GACATCTTTTAGTGTGTTACTGG + Intronic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157870931 18:51229574-51229596 GATAGCTCTTGGTCTGCTACTGG - Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159094161 18:63883215-63883237 AACAACACTTTGTTTGTTAACGG - Intronic
1159152205 18:64535031-64535053 GACAGCTCTTGGCATGTTACTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159559104 18:69975344-69975366 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1159711301 18:71764131-71764153 GACAACTCTTGGTTTGTTACTGG + Intronic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160458768 18:79021649-79021671 GCCAACTCTTAGCTTGTAACGGG - Intergenic
1164097085 19:22021336-22021358 GACAACTCTTGGCCTATTACTGG - Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
925460727 2:4060453-4060475 GACAGCTCTTTGTCTATTACTGG + Intergenic
925499407 2:4486917-4486939 GAAAGCTCTTGACTTGTTACTGG - Intergenic
926003718 2:9354783-9354805 AACAACTCTTGGTAAGTGACTGG - Intronic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927397191 2:22666219-22666241 GGCAACTTATGGTTTGTTAATGG - Intergenic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
928523540 2:32115413-32115435 CAAAACTCTAGGTATGTTACTGG - Intronic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
929550262 2:42886039-42886061 GACAACTCTTGGACTGTTACTGG + Intergenic
930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG + Intergenic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935944629 2:108274356-108274378 GACAGCTCTTGGCCTGCTACTGG - Intergenic
936157763 2:110059910-110059932 TAGAAATCTGGGTTTGTTACAGG - Intergenic
936186929 2:110311534-110311556 TAGAAATCTGGGTTTGTTACAGG + Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG + Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939562255 2:143746143-143746165 GAAAAGTCTTGGTTTCTTACGGG - Intronic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
941330667 2:164174556-164174578 GACAGCTCTTTGCCTGTTACTGG - Intergenic
941802500 2:169675825-169675847 TACAACTGTTGGTTTTTTAAAGG - Intronic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943317928 2:186412310-186412332 GACAGCTCTTGGTCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
944864779 2:203849683-203849705 AAAAGCTCTTGATTTGTTACTGG + Intergenic
945642179 2:212443846-212443868 GACAGCTCTTGGACTATTACTGG + Intronic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
945725844 2:213471486-213471508 GACAGATGTTGGTCTGTTACTGG - Intronic
945960138 2:216124969-216124991 GTTAACTCTAGGTTTCTTACTGG - Intronic
946527867 2:220539958-220539980 GACAGCTCTTGGCCCGTTACTGG - Intergenic
946728076 2:222681715-222681737 GACAACTCTTGGTGGGCTCCAGG - Intronic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
948095632 2:235331951-235331973 GCAACCTCTTGGTTTGTTCCTGG - Intergenic
1170967872 20:21092217-21092239 GATTACTCTTGGTTTATTTCGGG + Intergenic
1175030280 20:55946659-55946681 GAATAATCTTGGTTTGTTAGAGG - Intergenic
1175750943 20:61497174-61497196 GACAACCCTTGCCTTGTAACAGG + Intronic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177747948 21:25243914-25243936 GACAACTGTTTGATTGTTTCTGG + Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1179415149 21:41192512-41192534 GAGAGCTCTTGGCCTGTTACTGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181367436 22:22388935-22388957 GACAGCTCTTGGCCTATTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949245869 3:1924931-1924953 GACAGCTCTTGGTCTGTTACTGG + Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951970762 3:28441857-28441879 GACAGCTCTTGGTCTGTTACTGG - Intronic
952084769 3:29805492-29805514 GACAGCTCTGTGTATGTTACTGG + Intronic
952490813 3:33870845-33870867 GACTACTCTTGTTTTGTTTTTGG + Intergenic
952605444 3:35142007-35142029 GACAGCCCTTGGCTTGTTACTGG - Intergenic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
955281618 3:57599617-57599639 GACAACTTTTGTTTTGGTTCAGG - Intergenic
956360453 3:68441446-68441468 GATAGCTCTTGGCCTGTTACTGG + Intronic
956509662 3:69980380-69980402 GACAGCTCTTGGCCTATTACTGG + Intergenic
956703894 3:71982879-71982901 GACAGCTCTTGGCCTATTACTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959439510 3:106359190-106359212 GACAACGCTTGGCCTTTTACTGG + Intergenic
959746013 3:109777265-109777287 GACAGCTTTTGGACTGTTACTGG - Intergenic
960349530 3:116575709-116575731 GACAGCTCTTGGTCTGTTACTGG + Intronic
960817721 3:121689832-121689854 CACCACTCTTGGCTTGTTAGGGG - Intronic
963115131 3:141721796-141721818 AAGAACTCTTGGTATGTTACTGG + Intergenic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
963630310 3:147723228-147723250 GACATCTTCTGGTCTGTTACTGG + Intergenic
963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG + Intergenic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965251332 3:166348259-166348281 GACAGCTCTTGGTCTGTTACTGG - Intergenic
965666096 3:171094923-171094945 GACAACTCTAGGCTGGGTACTGG - Intronic
965837086 3:172864693-172864715 CACACCTCTTGTTTTGTTTCTGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966445694 3:179998567-179998589 GACAGCTCTTGGTCTGTTACTGG + Intronic
966781102 3:183584826-183584848 GACAGCTAATGGTTTTTTACAGG - Intergenic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
969585472 4:8088876-8088898 GACAGGTCTTGGTTTGATTCTGG - Intronic
970260854 4:14222966-14222988 GACAACTATTGGATTGTTGCTGG - Intergenic
971897541 4:32617013-32617035 GACAGCTCTTGGCTTGCTACTGG + Intergenic
972094050 4:35326102-35326124 CACAACTCTTGGCTTGACACGGG + Intergenic
972805917 4:42529335-42529357 GACAGCTCTTGGCTTGTTACTGG + Intronic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
973966712 4:56170362-56170384 GAGAACTCTTGGTTTTTCCCTGG - Intronic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
974746914 4:66088897-66088919 GACAGCTCTTGGTCTGTTACTGG - Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976034205 4:80795814-80795836 GACAGATCTTGGTCTGTTAGTGG - Intronic
977031623 4:91891415-91891437 GACAGCTCTTTTTCTGTTACTGG + Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977466002 4:97383382-97383404 GACAACTCTTGGTCTGTTACTGG + Intronic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977626275 4:99192646-99192668 GATAGCTCTTGGCCTGTTACTGG - Intergenic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
978966853 4:114750950-114750972 GACAGCTCTTGGGCTTTTACTGG + Intergenic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980385788 4:132087023-132087045 GACAGCTCTCTGTTTGTTATTGG - Intergenic
980387946 4:132111173-132111195 GACAACACTTGGCCTGTTACTGG - Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982507926 4:156242980-156243002 GACAAATCTTGGATAGTTATTGG - Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982835540 4:160116649-160116671 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG + Intergenic
984060283 4:174982016-174982038 GACAGCTCTTGGCCTGCTACTGG - Intergenic
985934681 5:3087926-3087948 GACAGCTCTTGCTTTTTTTCCGG - Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986938331 5:12918742-12918764 GACAGCTCTTGGCCTATTACTGG - Intergenic
987108043 5:14660268-14660290 AACAACTTTTGGTTTGCTACTGG - Intergenic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
987468188 5:18296976-18296998 GACAGCTCTTGGCCTATTACTGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988107759 5:26772555-26772577 GACAGCTCTTGGCTTTTTGCTGG + Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988562131 5:32290856-32290878 GACAGCTCTTGGCCCGTTACTGG + Intronic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991330736 5:65489675-65489697 GACAGTTCTTGGCTGGTTACTGG - Intergenic
991726179 5:69537899-69537921 GACAGCTCTGGGTGTGTTATTGG - Intronic
991868777 5:71089973-71089995 GACAGCTCTGGGTGTGTTATTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993245137 5:85441307-85441329 AAAAACTCTTGGTATGCTACTGG + Intergenic
993319827 5:86458587-86458609 GATAGCTCTTGGCTTGTTACCGG + Intergenic
993367467 5:87050947-87050969 CACAGCTATTGGTCTGTTACTGG - Intergenic
993780694 5:92062403-92062425 GACAGCTCTTGACTTGTTACTGG + Intergenic
994098816 5:95872638-95872660 GACACATTTTTGTTTGTTACTGG + Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994855434 5:105113575-105113597 GACAGCTCTTGGCATGTTACTGG - Intergenic
994937957 5:106280424-106280446 GACAACTCTTTTTTTATTCCAGG + Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996018561 5:118567865-118567887 GACAGCTCTTGGTCTGTTACTGG + Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
997310220 5:132873605-132873627 ATCAACTCTTGCATTGTTACTGG - Exonic
998290335 5:140908542-140908564 GACAGCTCTTGGCCTATTACTGG - Intronic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
1000203534 5:159035363-159035385 TAAAACTCTTGGTTTCTTCCTGG - Intronic
1000223244 5:159234239-159234261 CACAGCTCTTGGCTTGTTACTGG - Intergenic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1001835001 5:174824321-174824343 GACACTTCTTGGTTTGTCAGTGG + Intergenic
1003429411 6:6025270-6025292 CACAACTCCCTGTTTGTTACAGG - Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG + Intergenic
1003803378 6:9697352-9697374 GATTACTCTTTGTTTGCTACTGG + Intronic
1004824288 6:19403226-19403248 GACAGCTCTTGGACTGTTACTGG - Intergenic
1005836476 6:29713255-29713277 AGCAACTTTTGGTATGTTACTGG + Intergenic
1006001557 6:30969085-30969107 GACAGCTCTTGGCCTATTACTGG + Intergenic
1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG + Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1009563205 6:65275251-65275273 AACAGCTGTTGGTATGTTACTGG + Intronic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1009712977 6:67348209-67348231 GACAACATATGGTTTGATACTGG + Intergenic
1010119545 6:72358755-72358777 GACACCTTTTGCATTGTTACAGG + Intronic
1010303331 6:74286933-74286955 GAAAACTCTTGGTTTTTAAAGGG + Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1014363396 6:120508344-120508366 GAGAGCTCTTGGCCTGTTACTGG - Intergenic
1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG + Intronic
1014631641 6:123796811-123796833 GACATCTCTTGACCTGTTACTGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015376523 6:132516175-132516197 GAAAACCCCTGGTTTGTGACTGG - Intergenic
1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1016576257 6:145572577-145572599 GACAGCTCTTGGTCTGTTACTGG - Intronic
1017219816 6:151952978-151953000 GAGAACACTTGTTTTGTTAAAGG - Intronic
1017977115 6:159368047-159368069 GACAGTTCTTGGTTTGTTACTGG - Intergenic
1018122927 6:160655213-160655235 GACAGCTATTGGTCTGTTATTGG - Intronic
1018182338 6:161235019-161235041 GACAAGGCTTGGTTTGTTTTGGG + Intronic
1018189124 6:161292912-161292934 GAATACTCTTGGTTTGAGACTGG + Intergenic
1018535030 6:164810484-164810506 GACCACTCTTGGCCTGTTACTGG - Intergenic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1022895913 7:34750364-34750386 GACAACTTTTGGTTTCTTTTCGG + Intronic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024866104 7:53906353-53906375 GACAGTTCTTGGCTTGTTACTGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028229227 7:88286858-88286880 GACTACTCTTGGTTTGAGACTGG - Intronic
1028237821 7:88382830-88382852 GACAGCTCTTGGCCTATTACTGG + Intergenic
1028880372 7:95873179-95873201 GAGATGTCTTGGTTTGCTACTGG - Intronic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1037953618 8:23036110-23036132 AACAGCTCTTGGCTTGTTTCTGG + Intronic
1039310062 8:36307812-36307834 GAAAACTCATGGATTTTTACTGG - Intergenic
1040911946 8:52528426-52528448 GACAGCTCTTGGCGAGTTACTGG + Intergenic
1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG + Intergenic
1042001060 8:64123988-64124010 GACAGCTCTTGGCTTGTTACGGG - Intergenic
1042210759 8:66378038-66378060 GATAATTCTTTGTTTGTCACTGG - Intergenic
1044285973 8:90412438-90412460 GACAGCTCTTGTTCTGCTACTGG - Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1044633154 8:94298398-94298420 GGCAGCTCTTGGCTTGTTACTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1050233799 9:3556836-3556858 TACACCTCTGGGTTTGATACTGG - Intergenic
1050288222 9:4126264-4126286 GAAAAAACTTGGTTTGATACAGG - Intronic
1050482675 9:6102611-6102633 GACAGCTCTTGGCCTATTACTGG + Intergenic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1052895472 9:33743610-33743632 GACAATTCTTGGTCTGCTACTGG - Intergenic
1055903940 9:81271196-81271218 GATACCTCTTGGCCTGTTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1058239798 9:102542501-102542523 GACAGCTCTTAGCTTGCTACCGG + Intergenic
1058544165 9:106042742-106042764 GACAGCTCTTGGCCTATTACTGG - Intergenic
1059196505 9:112375860-112375882 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1059314705 9:113414225-113414247 GACCACTCTTGGTTTGTAGATGG + Intronic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1190255320 X:48758146-48758168 AACAGCTCTTGGTCTGCTACTGG + Intergenic
1190601537 X:52097827-52097849 AACAGCTCTTGGTCTGCTACTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191658804 X:63629799-63629821 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1191946354 X:66539018-66539040 GACTGCTCTTGGTCTGTTACTGG + Intergenic
1192898704 X:75471916-75471938 GACAGCTCTTGGCCTATTACTGG + Intronic
1192996193 X:76515584-76515606 AACAGCTCTTGGCATGTTACTGG + Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193187372 X:78529208-78529230 AACAACTTTTGGTTTATTATTGG + Intergenic
1193205008 X:78737565-78737587 TACAAGTGTTGGTTTGTTTCTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194239914 X:91433088-91433110 GACAACATTTAGTTGGTTACAGG + Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194849245 X:98852168-98852190 GACAGCTCTTGGTCTGTTACTGG - Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196097079 X:111811839-111811861 GAGAACTCAAGGTTTGTTCCTGG - Intronic
1196135968 X:112209837-112209859 GACAGCTCTTGGACTGTTACTGG - Intergenic
1197002290 X:121452930-121452952 GATAGCTCATGGTCTGTTACTGG + Intergenic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197084195 X:122453493-122453515 GACAGCTCTTGGCTTGTTGCTGG - Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197380000 X:125727899-125727921 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG + Intergenic
1199040592 X:143111106-143111128 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199310426 X:146314394-146314416 GACAGCTCTTGGCCCGTTACTGG - Intergenic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200746057 Y:6904866-6904888 GATAGCTCTTGGCTTATTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201787228 Y:17798353-17798375 GACTACTTTTGTTTTGTTAGGGG - Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1201814325 Y:18107635-18107657 GACTACTTTTGTTTTGTTAGGGG + Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic