ID: 1159712144

View in Genome Browser
Species Human (GRCh38)
Location 18:71774059-71774081
Sequence CTGGAAACTAAAATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159712144_1159712151 7 Left 1159712144 18:71774059-71774081 CCCTCCCCCATTTTAGTTTCCAG 0: 1
1: 0
2: 1
3: 26
4: 320
Right 1159712151 18:71774089-71774111 TATCTCCATCTTTGTGTTCATGG 0: 1
1: 0
2: 1
3: 30
4: 286
1159712144_1159712152 8 Left 1159712144 18:71774059-71774081 CCCTCCCCCATTTTAGTTTCCAG 0: 1
1: 0
2: 1
3: 26
4: 320
Right 1159712152 18:71774090-71774112 ATCTCCATCTTTGTGTTCATGGG 0: 1
1: 0
2: 2
3: 30
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159712144 Original CRISPR CTGGAAACTAAAATGGGGGA GGG (reversed) Intronic
903279427 1:22242124-22242146 CTGGAAATCAAGGTGGGGGAGGG + Intergenic
904871817 1:33624168-33624190 CTGGAATCTGAAGTGTGGGAAGG - Intronic
905779396 1:40694429-40694451 TTGTAAACAAAAATGAGGGAGGG - Intronic
906241715 1:44246293-44246315 CTGGGCAGAAAAATGGGGGAAGG - Intronic
906536189 1:46552195-46552217 CTGGCCACTAAAAGGGGGGTGGG - Intergenic
907385415 1:54122458-54122480 CTTGAAACTAAACTGGGGACAGG + Intergenic
907401373 1:54226956-54226978 CATGAAACTAAAATTGGGAAAGG + Exonic
907792475 1:57680850-57680872 CTGAAAATTAGATTGGGGGAAGG - Intronic
909520716 1:76565024-76565046 TTGGAAACGGAAATGGGGAAGGG - Intronic
909568936 1:77086162-77086184 CTGAAAATTAAACTGGGAGAAGG - Intergenic
910393244 1:86765689-86765711 CTGGAGACTAATATAGGGGGAGG - Intergenic
910796284 1:91100668-91100690 ATGGAGACTAAAATGGTGAAAGG + Intergenic
910905571 1:92174062-92174084 CTTCAAAATAAAATGGGGGTGGG + Intronic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
913083834 1:115415472-115415494 AAGGAAACTGAGATGGGGGAAGG - Intergenic
913459183 1:119065347-119065369 CAAGAAAATAAAATGGAGGAGGG + Intronic
913709426 1:121466952-121466974 CTTGAAAAAAAAATGTGGGATGG - Intergenic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
914914207 1:151808465-151808487 AAGGAAACTAAGCTGGGGGAGGG - Intronic
915982096 1:160426588-160426610 ATGGAAGCTAAAATGGGGTGAGG - Exonic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
916674045 1:167051450-167051472 CTGGAAACCATAATTTGGGAAGG + Intergenic
916916918 1:169417088-169417110 CTGGTTACCAAAATGGGGAAGGG + Intronic
917198145 1:172488117-172488139 ATGGAATCAAAAATGGGAGAGGG + Intergenic
917953395 1:180065190-180065212 CTGGAGATTGAAATGGGAGAAGG - Exonic
918175824 1:182044413-182044435 CTAGAAAATAAAATGAGAGAGGG - Intergenic
918316650 1:183328176-183328198 CTGAAAACTGAAAAGGGAGAGGG + Intronic
920832559 1:209478772-209478794 CTGGAAACTAGATTGAGGGCAGG - Intergenic
921320551 1:213934347-213934369 CTGGAAACGGAAAAGGGGGATGG + Intergenic
923597947 1:235375471-235375493 CTGGATACTAAAATGGGGCTGGG + Intronic
923900231 1:238318310-238318332 CAGGAAACTTACATGGTGGAAGG - Intergenic
924237335 1:242010227-242010249 TTGGAACCTAAAATTTGGGATGG - Intergenic
1064684819 10:17849556-17849578 CTAGAAACAAAAAGGGGGGTCGG - Intronic
1065699997 10:28415590-28415612 CTGGATACTACAAAGGTGGAAGG - Intergenic
1066087023 10:31981126-31981148 CTGAAGACTACACTGGGGGAGGG - Intergenic
1066150779 10:32614649-32614671 ATGGAGACTAAAATGTGGGAGGG - Intronic
1068150765 10:53127504-53127526 TAGGAAACTAAAATGGAAGATGG + Intergenic
1069728478 10:70596266-70596288 TTGGAAACAAACATGGGGGTGGG - Intergenic
1070444514 10:76483136-76483158 ATGCAAACTACAATGTGGGAAGG - Intronic
1073061555 10:100736595-100736617 CTGGAACCTGAGCTGGGGGAGGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074566625 10:114585253-114585275 CTGGAGACTAAAAAAGGGAAAGG - Intronic
1074750038 10:116576871-116576893 TTGTAAACTAAAAAGGGGCAGGG + Intergenic
1075222890 10:120600267-120600289 CTGGAAAGTCACAAGGGGGATGG + Intergenic
1075456964 10:122591141-122591163 CTTGAAACTAAAATGTTAGAAGG - Intronic
1075521600 10:123146822-123146844 CTGGAAACTGAAGTGAGGCAAGG - Intergenic
1076520337 10:131077166-131077188 CTGGCACCCAAAATGGGAGATGG + Intergenic
1076848574 10:133082024-133082046 CTGGACACTTGAGTGGGGGAGGG - Intronic
1078417391 11:11177165-11177187 ATGGAAACTGAAATTGAGGAAGG + Intergenic
1078627293 11:12969031-12969053 CTGGAAATTAGAAGGGAGGATGG - Intergenic
1079091589 11:17484348-17484370 CTGTAAACTTACATGGTGGAAGG - Intergenic
1079879842 11:25913012-25913034 CTGGAGACTCAAAAGTGGGAAGG + Intergenic
1080371061 11:31644148-31644170 CTGGATATTAAAATGTAGGATGG - Intronic
1082046164 11:47729506-47729528 CTCAAAAATAAAGTGGGGGAAGG - Intronic
1084136274 11:67184661-67184683 GAGAAAACTAAAATGGGGGTGGG - Intronic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1086974978 11:93121122-93121144 CTGGAACCTGGATTGGGGGAAGG - Intergenic
1088908385 11:114171737-114171759 CTGAAAACTAAAGTGGGAGACGG - Intronic
1088974392 11:114802864-114802886 CTGGAAAGTAAAATGAGTCATGG + Intergenic
1090233592 11:125128778-125128800 GTGGAAAGTAAAACTGGGGAAGG + Intergenic
1090259258 11:125306832-125306854 TGTGAAACGAAAATGGGGGAGGG - Intronic
1091987124 12:4919820-4919842 CAGGAAACAAAAGCGGGGGAGGG - Intronic
1092216874 12:6689477-6689499 CCGGAAACGAAAAGGGGGGAGGG + Exonic
1092845346 12:12579839-12579861 CTAGAAACTTAAAAGGGTGAGGG - Intergenic
1094581869 12:31740698-31740720 CTCAAAGCTAAACTGGGGGAGGG + Intergenic
1095905377 12:47371906-47371928 GAGGAAACCAAAATGGGAGAAGG + Intergenic
1096773122 12:53949188-53949210 CTGGAGACTAAGATGTGGGTGGG - Intergenic
1098721896 12:73910733-73910755 CTCGAAACTGAAATGGGGATTGG + Intergenic
1099164156 12:79281519-79281541 CTGGAGACTCAAAAGTGGGAAGG + Intronic
1099293561 12:80802534-80802556 TTGGAAAATAATATGGAGGAGGG - Intronic
1099663711 12:85598673-85598695 CTGAAAATGAAAATGAGGGAAGG + Intergenic
1100027704 12:90150199-90150221 CTGGAACCTCACATGGTGGAAGG - Intergenic
1100458318 12:94774412-94774434 CTGGAAACTAGAATTGAGTAGGG + Intergenic
1100884433 12:99054494-99054516 ATGGAAACTAGAATGGGGAGCGG - Intronic
1100986261 12:100204133-100204155 CTTTAAAAAAAAATGGGGGAGGG + Intronic
1101416214 12:104510339-104510361 CTTGAACCAGAAATGGGGGAAGG + Intronic
1104272299 12:127293312-127293334 CTGGAAAACAAAACGAGGGAAGG - Intergenic
1104467177 12:128999962-128999984 CTGGAATCTGAAATCAGGGATGG + Intergenic
1105398805 13:20069271-20069293 CAGGAGAGAAAAATGGGGGAAGG - Intronic
1106238606 13:27888086-27888108 CTGGACTCCAAAATGGGGTAGGG + Intergenic
1106417187 13:29555658-29555680 CTGGAAAAAAAAAGGGGGGGCGG + Intronic
1106565073 13:30877226-30877248 CTGGAATCCAAAATCAGGGAAGG + Intergenic
1108870335 13:54976710-54976732 AGGGAAACTAAAGTGGGTGAAGG - Intergenic
1109655897 13:65389230-65389252 CTGAAAATTAAAATAGGTGAAGG - Intergenic
1109797837 13:67340399-67340421 ATCGAAACTTAAATGGGGAAAGG - Intergenic
1110508185 13:76314779-76314801 CAGGCAACTATAAAGGGGGAAGG - Intergenic
1112227828 13:97557982-97558004 CTGGAGAGTAACATGTGGGACGG - Intergenic
1112240758 13:97679083-97679105 GTGGAAGGTGAAATGGGGGAAGG - Intergenic
1112828904 13:103424503-103424525 CTGGAAAGTAAAAATGTGGATGG + Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1115470351 14:33762424-33762446 CTTTAAAATAAAAAGGGGGAGGG + Intronic
1116348694 14:43830475-43830497 ATGGAATCCAAAATGGAGGAGGG + Intergenic
1116844918 14:49856274-49856296 CTGGAATCTAGAATGAGAGATGG + Intergenic
1117228308 14:53687084-53687106 AGGGAATCTAGAATGGGGGAAGG + Intergenic
1118232226 14:63963647-63963669 CTCCAAGCCAAAATGGGGGAGGG + Intronic
1118748152 14:68789001-68789023 CGGGAGACTGAAATGAGGGAAGG + Exonic
1119002628 14:70896668-70896690 CTGGGGACTATAAGGGGGGAAGG + Intergenic
1121267738 14:92615344-92615366 CTGCCAAGGAAAATGGGGGAAGG - Intronic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1124378946 15:29148414-29148436 CTGGATACTAAAATCGGTGGAGG + Intronic
1124716206 15:32064721-32064743 CTGGAAACCAAAACAAGGGAGGG + Intronic
1126763673 15:51992607-51992629 TTGGCATCTAAAATGGGGGACGG - Intronic
1127632330 15:60838682-60838704 CTGGAAACTGAAAGCAGGGAGGG - Intronic
1127775850 15:62263893-62263915 CTGGGAACTGGACTGGGGGAAGG - Intergenic
1128883133 15:71261573-71261595 CTGGAACCTAGTTTGGGGGATGG + Intronic
1129205410 15:74034565-74034587 CTGGGACCTGAAATGGGGGGAGG - Intronic
1130138141 15:81198655-81198677 CTGGGAACCAGAAAGGGGGAGGG - Intronic
1130742085 15:86611914-86611936 CTGGTATTTAAAATGGGGGCAGG + Intronic
1131376602 15:91929414-91929436 CTGGAGATTAAATTGGGTGAGGG + Intronic
1131384329 15:91990783-91990805 CTGTATTCTAGAATGGGGGATGG - Intronic
1131551588 15:93361998-93362020 CTGGAAATAAACATGGGGGAGGG - Intergenic
1133444364 16:5847352-5847374 CTGAAAAAAAAAATGGGGGTGGG + Intergenic
1136178517 16:28535111-28535133 CTGGGAAGTGAGATGGGGGAGGG - Intronic
1137867610 16:51917056-51917078 CTGGAAAGTAAAGTGGGGAGAGG - Intergenic
1137902740 16:52286841-52286863 CTGGAAACTACTAGAGGGGAAGG + Intergenic
1138791520 16:59909317-59909339 CTGGAATGTAAAAGGGGGCACGG - Intergenic
1139158818 16:64478088-64478110 CAGGAAATTAAAATGGCAGAGGG + Intergenic
1139875244 16:70140834-70140856 ATAGAAAAGAAAATGGGGGAGGG + Intronic
1140345510 16:74209233-74209255 TAGGAAACTAACATGAGGGAGGG + Intergenic
1140906168 16:79411104-79411126 GTGGAAACTAAAATGGGACAAGG - Intergenic
1141658438 16:85428749-85428771 CTGGTAACTAGAATGGGGGGTGG - Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1142841399 17:2634097-2634119 CAGGAAACTAGAATGTGTGAGGG - Intronic
1143332089 17:6144953-6144975 CTGGAAACAAGAATGGAAGATGG - Intergenic
1144744774 17:17606760-17606782 CTGGGACCTAGGATGGGGGAGGG - Intergenic
1148853197 17:50564769-50564791 TTGGAAATTAAATTGGAGGAGGG - Intronic
1149879767 17:60277551-60277573 TTGTAAACTAAAATGTGGTAAGG + Intronic
1150285724 17:63952765-63952787 CTGGAAAATAAAGTGGGTGGGGG - Intronic
1150911850 17:69395972-69395994 ATGGAAACCAGAATGGGTGATGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1157781986 18:50447614-50447636 CTGGAAACTATAAGGGTGGCAGG + Intergenic
1159149796 18:64505975-64505997 ATGGAAACAACACTGGGGGATGG - Intergenic
1159400909 18:67932746-67932768 GTGGAAACTTAAATGGGTTATGG + Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1160051394 18:75437437-75437459 CTGGAAAGGGTAATGGGGGAGGG + Intergenic
1160239427 18:77112559-77112581 CTGGAAACAGAGAAGGGGGAGGG - Intronic
1162427222 19:10603672-10603694 CTGGAAGCTTCAATTGGGGAGGG - Intronic
1162464747 19:10832903-10832925 CAGGAAACTAAAATTGGGGAGGG + Exonic
1163023769 19:14497493-14497515 GGGCAAACTAAAATGGGAGATGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1166254322 19:41591742-41591764 CTGGAAATTTAATTGGGGAAGGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167870394 19:52364657-52364679 CTTGAACCTCACATGGGGGAAGG - Intronic
1168072146 19:53959275-53959297 CGCGAAACAGAAATGGGGGAGGG - Intergenic
1168198812 19:54797712-54797734 CTGGGAACTAAATTGGGGAGTGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925517130 2:4695402-4695424 CAGGAAACAAAAGTGGGAGAAGG + Intergenic
927188405 2:20499042-20499064 CTGAAAAGTAAAATGGTGCATGG - Intergenic
928382031 2:30826265-30826287 CTGGCATGTAAAATGGGAGATGG + Intergenic
930076970 2:47413997-47414019 ATCAAAACTAAAATGGGGGCCGG - Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
931338181 2:61370877-61370899 GTGGAAATTAAAAAGTGGGAAGG - Intronic
931528617 2:63186716-63186738 CTGGAAAATAAAAGGTGAGAAGG - Intronic
932311330 2:70744742-70744764 CTGAAAAATAGAATAGGGGATGG + Intronic
936546892 2:113398963-113398985 ATGGAAACTAAAATAGAGTAGGG - Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
937849658 2:126621117-126621139 ATGGAAACTAGAATTCGGGATGG + Intergenic
938273387 2:129994188-129994210 CATGAAACTAAAATTGGGAAAGG - Intergenic
938442827 2:131351912-131351934 CATGAAACTAAAATTGGGAAAGG + Intronic
939712228 2:145536647-145536669 CTGGAAACTAGAATTCCGGAGGG - Intergenic
941442333 2:165553898-165553920 ATGGAAGGTAACATGGGGGAAGG - Intronic
941787601 2:169515354-169515376 CTGCACACTAAAATGGGACATGG + Intronic
941843255 2:170109876-170109898 CTAGACACTAAAATGTGGGGAGG - Intergenic
943143377 2:184011260-184011282 TTGGATACTTAAATGTGGGATGG + Intergenic
943984866 2:194605817-194605839 CTTTAAAAAAAAATGGGGGAAGG + Intergenic
944435611 2:199686040-199686062 CTGGAATCTAATGTGGGGCATGG + Intergenic
946192603 2:218015504-218015526 CTGGAATTTGAAAGGGGGGATGG - Intergenic
946478894 2:220034516-220034538 CTGGAAGGTAGAGTGGGGGAAGG + Intergenic
946551687 2:220808279-220808301 CTAGAAGCTGAAAAGGGGGAAGG + Intergenic
947170679 2:227308083-227308105 CTGGAATGTAAAATGGTGGAAGG + Intronic
947191076 2:227505507-227505529 CTGGAAAGTAAAAAGATGGAGGG - Intronic
947429445 2:230013236-230013258 ATGGAAAATGAGATGGGGGAGGG - Intergenic
1169985401 20:11437763-11437785 CAGGAGACAAAAATGCGGGAAGG - Intergenic
1170063800 20:12288675-12288697 CTGGCAGCTCAAATGGGGGTGGG - Intergenic
1172168399 20:32913308-32913330 CTGTAAACTTACATGGTGGAAGG + Intronic
1172370538 20:34386865-34386887 GTGGAAACAAAAATGTGGAAAGG - Intronic
1172572626 20:35982396-35982418 CGGGAAAGGAAAATGGGAGAAGG - Intronic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1173215091 20:41073836-41073858 CTGCCAACTATAGTGGGGGAGGG - Intronic
1175255266 20:57641156-57641178 CTGGGAACTCATATGGTGGAAGG - Intergenic
1175709622 20:61208963-61208985 CTGGAAAAAAAAAAGGGGGGGGG - Intergenic
1177090920 21:16767268-16767290 ATAGAAAGTAAAATGGTGGATGG + Intergenic
1178025344 21:28460091-28460113 ATGGGATCTAAAATGGTGGATGG + Intergenic
1180167568 21:46037964-46037986 CTGGAGAATAAAGTGGGTGAAGG - Intergenic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182210230 22:28670085-28670107 CTGAAAATAAAAATGGGGGGGGG + Intronic
1182459413 22:30473170-30473192 CTGGAATGTGAAATGGGGCAGGG - Intergenic
1182518832 22:30873777-30873799 GTGGAGCCTAAAATGAGGGATGG + Intronic
1182844372 22:33418397-33418419 CTGGATACTAGGATGGGGGTGGG + Intronic
949133782 3:537348-537370 CTGAATAATAAAAGGGGGGAGGG + Intergenic
949797581 3:7867707-7867729 CCGGGAACTGAAATGGGGAATGG + Intergenic
951203184 3:19897279-19897301 CTGGAAACTCACATAGGAGAGGG - Intronic
951503269 3:23414406-23414428 CTGAAAGCTCAAATGAGGGAAGG - Intronic
951828296 3:26894039-26894061 GGGGAAACTAAAATAAGGGATGG - Intergenic
951880476 3:27476726-27476748 CAGGAAACAAATATGGTGGAAGG - Intronic
952533992 3:34291120-34291142 CTGGAGACTACAATGGGACATGG + Intergenic
953488683 3:43328207-43328229 CTGAAACCGTAAATGGGGGATGG - Intronic
953876299 3:46668640-46668662 GTGGGAACTAGAATGGTGGAGGG + Intergenic
954013947 3:47668846-47668868 CTGCACACTAGCATGGGGGAAGG + Intronic
954975812 3:54693186-54693208 CTTAACACTAAAATGTGGGAAGG + Intronic
955841434 3:63117000-63117022 CTGGAAACTGTAAAGAGGGAGGG - Intergenic
957134665 3:76270533-76270555 CTTAAAAATAAAGTGGGGGATGG - Intronic
957890187 3:86346598-86346620 CAGAAAACTAAAATGGAGAAAGG + Intergenic
961130353 3:124460363-124460385 GTGGAAAATAAAATGGGGTGGGG + Intronic
962525481 3:136234134-136234156 CTGTAAGATAAAATGGGGGGAGG - Intergenic
962851932 3:139314399-139314421 CTGGGAAGAAAAATGGGGGAAGG + Intronic
962906190 3:139805236-139805258 TGGGACACTAAAATGAGGGATGG - Intergenic
963179754 3:142341742-142341764 ATGGAAACCAAAATGGAGCAGGG + Intronic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
963688603 3:148470319-148470341 TTGGAAAAAAAAATGGTGGAGGG + Intergenic
963768951 3:149368950-149368972 CTGGAAAAAAAAAAGGGGGGGGG + Intergenic
964863643 3:161229981-161230003 ATAGAAATTAAAATGGGAGAAGG + Intronic
965514716 3:169608548-169608570 CTGGAAACACAAATGGAGGGAGG - Intronic
966258084 3:177942363-177942385 CTGGAAACTTAAAGGGGTAAGGG + Intergenic
967537358 3:190622468-190622490 CTGGAATCTAAAGTAGGGGGTGG - Intronic
969087819 4:4669557-4669579 AAGGAAAGTAAAATGGGGGAGGG - Intergenic
969250322 4:5963860-5963882 CAGGGAACTAAAATGGGGTAGGG + Intronic
970932007 4:21523085-21523107 CTGTAACCTAACATGGTGGAAGG - Intronic
971083404 4:23242077-23242099 CTGGAAAATAAAACAGGGGAGGG - Intergenic
971214535 4:24650961-24650983 CTGGATACTTTGATGGGGGAAGG + Intergenic
971501766 4:27326043-27326065 CTTTAAACTAAATTGGAGGAAGG - Intergenic
971679612 4:29679663-29679685 TGAGAAACTAAAATGGGGAAAGG + Intergenic
972574082 4:40335735-40335757 CTGAGGTCTAAAATGGGGGATGG - Intronic
973250934 4:48059191-48059213 CTGGCAGCTAATATGAGGGATGG + Intergenic
973370247 4:49240206-49240228 CTGGAAAATAAGAACGGGGAGGG - Intergenic
973390782 4:49555214-49555236 CTGGAAAATAAGAACGGGGAGGG + Intergenic
973891835 4:55375229-55375251 CTGGCCTCTATAATGGGGGAGGG + Intergenic
974204019 4:58675692-58675714 CTGGAAACTGAAATATGAGAAGG - Intergenic
975171249 4:71234182-71234204 GTGGAAAATAAAATGAGGCAGGG - Intronic
975674998 4:76818572-76818594 ATGGAAACTAAAAAGGAGCAAGG - Intergenic
976471024 4:85429345-85429367 CTTGAAAGCAAAATGAGGGAAGG + Intergenic
977184521 4:93920147-93920169 ATAGCAGCTAAAATGGGGGAGGG - Intergenic
979139828 4:117157869-117157891 ATGGAGACAAAAATGGGAGATGG - Intergenic
979274231 4:118796914-118796936 CTGGATACTACAATGGGTTATGG + Intronic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
980722015 4:136710253-136710275 TTTGAAAATAAAATAGGGGAAGG - Intergenic
981471497 4:145140545-145140567 TTGGAAACTAAAAAGGAGGGAGG + Intronic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983726813 4:170939934-170939956 TTTGAAAGTAAAATGGGGGACGG + Intergenic
985721357 5:1490948-1490970 CTGGAAACTGAACTGGGGTGGGG - Intronic
985947648 5:3199549-3199571 CTGGAAGCCAAACTGGGTGAGGG + Intergenic
986731366 5:10637072-10637094 CAGGACACTGAAGTGGGGGAGGG + Intronic
987304832 5:16627572-16627594 CTAGAACATAAGATGGGGGAGGG + Intergenic
988821230 5:34888129-34888151 CTGTAAACTCACATGGTGGAAGG - Intronic
989820763 5:45793575-45793597 CTGCAAAATAAAATAAGGGAAGG + Intergenic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
990321924 5:54638304-54638326 CTAAAAAATAAAAAGGGGGAGGG + Intergenic
990736611 5:58870745-58870767 CAGGAAACAAAAATGGTGTAAGG - Intergenic
991530397 5:67607901-67607923 CTGGCATCCGAAATGGGGGAGGG + Intergenic
991664693 5:68987139-68987161 ATAGCAATTAAAATGGGGGAGGG + Intergenic
992969279 5:82039139-82039161 CTGGGAACTAAAAGGGGGCCAGG - Intronic
993126054 5:83836882-83836904 CTGGAAGAAAAAGTGGGGGAAGG - Intergenic
993401305 5:87455959-87455981 CTGAAAAAAAAAATAGGGGAAGG + Intergenic
994456149 5:100010684-100010706 CAGGAAAAAAAAAAGGGGGACGG + Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
996990348 5:129622948-129622970 GTGGAAACTACAAACGGGGAGGG + Intronic
997179351 5:131812452-131812474 CTGGAAATTACAAAGGTGGAAGG - Intronic
997801674 5:136868930-136868952 CTGGAAACTAAGATTTGGGAAGG + Intergenic
997814713 5:137004940-137004962 CAGGAAAGTAAAATAAGGGAAGG + Intronic
998874919 5:146589436-146589458 ATGGAAAAAAAAATGGTGGAGGG + Intronic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1002984476 6:2175594-2175616 CTGGAAAGTTAAATTGGAGAGGG - Intronic
1005533068 6:26727976-26727998 CTGGAAACTTAAGTGGGACATGG + Intergenic
1005537726 6:26773688-26773710 CTGGAAACTTAAGTGGGACATGG - Intergenic
1005762429 6:28979780-28979802 CTGGAAACTTGCATGGGGGAAGG + Intergenic
1006110870 6:31744349-31744371 CTGAAAAGTAAAGTGGGGGTGGG + Intronic
1008676106 6:53820590-53820612 CTGAAGAATAAAATGGGGGCGGG - Intronic
1009008597 6:57816101-57816123 CTGGAAACTTAAGTGGGACATGG - Intergenic
1009465550 6:63964112-63964134 CTTCAAATTAAAATGGGGGAAGG - Intronic
1009928647 6:70149925-70149947 GTGCAGATTAAAATGGGGGAGGG - Intronic
1010658305 6:78538805-78538827 CTGGGAACAAAAATGGAGGCAGG + Intergenic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1011994964 6:93574874-93574896 TTGGAAAGTAGAATGGGGGCTGG - Intergenic
1012383473 6:98648818-98648840 CTGGAAACTAGTAGAGGGGAAGG + Intergenic
1012468454 6:99541875-99541897 CTTCAAAATAAGATGGGGGATGG + Intergenic
1012806617 6:103902901-103902923 CTGGTAACTAACTTGGTGGAGGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013815705 6:114094983-114095005 CTGGAGACTAAACTAAGGGAAGG - Intronic
1015548333 6:134385619-134385641 CAGGAAAGTAACATGAGGGAAGG - Intergenic
1016469082 6:144356074-144356096 CTGGAACCTCAAAAGGGGGAAGG + Intronic
1017296887 6:152807937-152807959 CTGGAAATGAAAATGGAGGAAGG - Intergenic
1017545246 6:155444135-155444157 CTGTATACTAAAATGTGGAAAGG - Intronic
1018021550 6:159765805-159765827 CTGGAAACTAAAAACGGGTAAGG - Intronic
1019633483 7:2063031-2063053 CTAGAAAGAAAAATGAGGGAAGG + Intronic
1019842060 7:3457036-3457058 CTGGGAACTTTAATGGGGGAAGG + Intronic
1020341769 7:7118707-7118729 CTGGAAAATAAAAAGAGAGAGGG - Intergenic
1020804756 7:12775249-12775271 CTGGACACTAAAAGAGAGGAGGG + Intergenic
1020913203 7:14159308-14159330 CTGAAAACTAAAAGAGGAGAAGG - Intronic
1021595302 7:22309472-22309494 CTGGCAACTAAAATAGGTGATGG - Intronic
1022470932 7:30681602-30681624 CGGGAACCTACAATGAGGGAAGG + Intronic
1023406162 7:39834871-39834893 CATGAAACTAAAATTGGGAAAGG - Intergenic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1024785041 7:52897930-52897952 ATGGAAACTGTAATGGGAGATGG - Intergenic
1028806802 7:95037112-95037134 CTGGAAAAAAAAGAGGGGGAGGG + Intronic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029152079 7:98487852-98487874 CAGGAGACTATGATGGGGGAGGG - Intergenic
1031465096 7:122099866-122099888 CTGGAAGGTGAAATGGGAGATGG - Intronic
1031487648 7:122348113-122348135 ATGGAAACAAAAATGGGGTTGGG - Intronic
1031735369 7:125352980-125353002 CTGGGAACTCAAAAAGGGGAAGG + Intergenic
1035954869 8:4065971-4065993 GTGAAAAATAAAATAGGGGAAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037054808 8:14426364-14426386 CTGTTAACCAAATTGGGGGAGGG - Intronic
1038552772 8:28484248-28484270 CTGGAAATTAAGAGGGGAGAAGG - Intronic
1039438986 8:37581595-37581617 TTTGAAACTCAAATGGGGCAAGG + Intergenic
1042281801 8:67064070-67064092 CTGGAAAGAAAAATGGGGAGGGG - Intronic
1043331456 8:79122559-79122581 ATGGAGAATAAAATGGGGGGCGG - Intergenic
1043611678 8:82071344-82071366 ATTGAAAATAAAATGGGGAAAGG - Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045225581 8:100241776-100241798 CAGAAAACAAAAAAGGGGGAAGG - Exonic
1045418967 8:101995196-101995218 CTGGCAACTAAGATGCGAGAAGG + Intronic
1048603704 8:135945942-135945964 CTGGTTAGTAAAATGGGAGATGG + Intergenic
1048758303 8:137763840-137763862 TGGGAATCTAAAATTGGGGAAGG - Intergenic
1050120609 9:2303514-2303536 CTTGAAACAAAAATGGGTCATGG - Intergenic
1050588224 9:7135368-7135390 CTGGAAAGAAAAAAGTGGGAAGG - Intergenic
1051533454 9:18130953-18130975 TTGGAAACTAAAATCTGGGTGGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1055110159 9:72551479-72551501 CTGGCAACTCAACAGGGGGAAGG - Intronic
1055277784 9:74639368-74639390 CTGCAAACTGACATGGGGAAGGG + Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055768611 9:79692076-79692098 CTCAAAACTAACATGGGGGAGGG - Intronic
1055873301 9:80912244-80912266 CTGAAAACAAAAAGGGGGGTGGG - Intergenic
1055981275 9:82004316-82004338 TTGGAAAGTAAAATGGTAGACGG - Intergenic
1056119116 9:83469838-83469860 CAGAAAACTAAGATGGGGGGCGG + Intronic
1057189876 9:93081051-93081073 CTTGAAAATAATGTGGGGGAAGG - Intronic
1059770726 9:117422150-117422172 CTGGAAACTATAATTTAGGAGGG - Intergenic
1062241776 9:135544809-135544831 CAGGCAACAAAAATGGGGAACGG + Intergenic
1186479343 X:9884122-9884144 CTGGAAACTGCGATGGGGGGCGG - Intronic
1186721464 X:12308789-12308811 AAGGAAAAAAAAATGGGGGATGG + Intronic
1186782872 X:12930854-12930876 ATGGACACAAAGATGGGGGATGG - Intergenic
1187533215 X:20115216-20115238 ATGGAAACAAAATTGGGGAAGGG - Intronic
1188861020 X:35256368-35256390 CTGGAAACAAAAGTGGGGTGGGG + Intergenic
1189697443 X:43679283-43679305 CAGGAAACTAAAAGGGGAGGGGG - Intronic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192147522 X:68691738-68691760 CAGGAAACAAAAAAGGAGGAGGG - Intronic
1192245946 X:69371671-69371693 GTGGAAGCTAGAAAGGGGGATGG - Intergenic
1192616060 X:72623915-72623937 CTACAAAATAAAAGGGGGGAAGG + Intronic
1193144128 X:78059886-78059908 CTGGAAACAGAAATGGGTGTGGG - Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1194411104 X:93559330-93559352 TTGGACTCCAAAATGGGGGAGGG + Intergenic
1194993279 X:100568089-100568111 ATTGAAACTAAAGTGGGGAAGGG - Intergenic
1195112686 X:101663728-101663750 CTGGAAATGAAGATGAGGGAGGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198463564 X:136884988-136885010 CTGGAGACTGTATTGGGGGAGGG + Intergenic
1200827174 Y:7657698-7657720 CTGGACACTGAAATGGGGAGTGG - Intergenic
1200830315 Y:7682355-7682377 CAGGAAACTAAACAGAGGGAAGG + Intergenic
1202116662 Y:21475562-21475584 CAGGAAACTAAACAGAGGGAAGG - Intergenic