ID: 1159716914

View in Genome Browser
Species Human (GRCh38)
Location 18:71835451-71835473
Sequence GCTTCTAGCAAATGTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159716912_1159716914 9 Left 1159716912 18:71835419-71835441 CCACCTTTAATCTGGTGGGCACA 0: 14
1: 219
2: 286
3: 193
4: 209
Right 1159716914 18:71835451-71835473 GCTTCTAGCAAATGTAAAGCAGG No data
1159716913_1159716914 6 Left 1159716913 18:71835422-71835444 CCTTTAATCTGGTGGGCACAATC 0: 215
1: 280
2: 191
3: 136
4: 160
Right 1159716914 18:71835451-71835473 GCTTCTAGCAAATGTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159716914 Original CRISPR GCTTCTAGCAAATGTAAAGC AGG Intergenic
No off target data available for this crispr