ID: 1159724142

View in Genome Browser
Species Human (GRCh38)
Location 18:71932567-71932589
Sequence GAGGTACATCTGATTTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159724142_1159724151 24 Left 1159724142 18:71932567-71932589 CCCCCCAAAATCAGATGTACCTC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1159724151 18:71932614-71932636 GTGAATTTTTGGCCCCAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 122
1159724142_1159724148 -3 Left 1159724142 18:71932567-71932589 CCCCCCAAAATCAGATGTACCTC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1159724148 18:71932587-71932609 CTCTACCATGAAGACAGAAATGG 0: 1
1: 1
2: 4
3: 35
4: 466
1159724142_1159724150 13 Left 1159724142 18:71932567-71932589 CCCCCCAAAATCAGATGTACCTC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1159724150 18:71932603-71932625 GAAATGGTAGTGTGAATTTTTGG 0: 1
1: 0
2: 0
3: 22
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159724142 Original CRISPR GAGGTACATCTGATTTTGGG GGG (reversed) Intergenic
902536062 1:17119891-17119913 GAGGTTCATCTGACTGTTGGGGG - Intergenic
902767902 1:18629499-18629521 GGGGCTCATCAGATTTTGGGGGG - Intergenic
903422744 1:23230404-23230426 GAGGTCCACCTGAGTCTGGGAGG - Intergenic
905072771 1:35242025-35242047 AAGGTACATCCTTTTTTGGGGGG - Intergenic
906754258 1:48293566-48293588 AAGGTACTTCTGCTTTTGAGGGG - Intergenic
907787936 1:57632067-57632089 GAGGTATATGGGATTTAGGGAGG + Intronic
909156056 1:72077721-72077743 GAGGAACATTTGATCCTGGGAGG + Intronic
911546013 1:99217811-99217833 GAGGAGCCTCAGATTTTGGGAGG - Intergenic
919340549 1:196301238-196301260 GAGGTATGAATGATTTTGGGGGG - Intronic
919692406 1:200539738-200539760 GAGGATCACCTGAATTTGGGAGG + Intergenic
919866872 1:201789091-201789113 GAGGGCCATCTGATTGTTGGTGG + Intronic
920085055 1:203409229-203409251 GAGGCACAGCTGGGTTTGGGGGG + Intergenic
920438724 1:205964603-205964625 GAGGAACACCTCAATTTGGGAGG + Intergenic
921191825 1:212716278-212716300 GAGATACAACTGATTTTTGTAGG + Intergenic
921583821 1:216925566-216925588 GAGGTTTTTCTGTTTTTGGGGGG + Intronic
1062840549 10:666877-666899 TAGCTGCTTCTGATTTTGGGAGG - Intronic
1063652457 10:7951589-7951611 GAGGTGGACATGATTTTGGGTGG - Intronic
1064673000 10:17734751-17734773 CAGGTCCATCTGATTTTTGAAGG + Intergenic
1065193716 10:23240099-23240121 GAGGTTCACCTGAGTCTGGGAGG + Intergenic
1065633569 10:27707774-27707796 GAGGAACATTTCAGTTTGGGTGG - Intronic
1067581708 10:47450538-47450560 AAGGTACATCTGAGCCTGGGTGG - Intergenic
1068153052 10:53158797-53158819 GAGGTACAACTTCTTTTGGTGGG + Intergenic
1071098482 10:82008043-82008065 CAGGCACAGCTGGTTTTGGGGGG + Intronic
1071386185 10:85123710-85123732 GAGGTTCATCTGTATATGGGTGG + Intergenic
1071882884 10:89918611-89918633 GAGGTACAGATAATTTTAGGAGG + Intergenic
1072305170 10:94100322-94100344 GTGGTACCCCTGATTTAGGGAGG - Intronic
1073777733 10:106805323-106805345 GAGGTACCTCTGATGTTGTGAGG + Intronic
1077698942 11:4421912-4421934 AAGGTAACTTTGATTTTGGGAGG + Intergenic
1078602307 11:12744406-12744428 GAGGTACATAATATTCTGGGGGG - Intronic
1079570858 11:21942014-21942036 GAGGGACATCTCATTTTTGCTGG + Intergenic
1079620591 11:22549549-22549571 AAAGCACATCTGATTCTGGGAGG + Intergenic
1079958670 11:26895384-26895406 GAAGGACATCAGATTTTGGAGGG + Intergenic
1081466066 11:43318507-43318529 GAAATAAAGCTGATTTTGGGAGG - Intronic
1081578078 11:44332183-44332205 GAGGTGCTTCTGAGTGTGGGAGG - Intergenic
1082687428 11:56258274-56258296 TTGGCTCATCTGATTTTGGGAGG + Intergenic
1083727829 11:64637554-64637576 GATGCACATCTGAATTTGGGGGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1088219997 11:107559760-107559782 GAGGCACATTTGAATTTAGGAGG - Intronic
1089853515 11:121520171-121520193 GAGGATCATCTGAGTCTGGGAGG + Intronic
1089893330 11:121902955-121902977 GAGACACATCTGCTTTAGGGAGG + Intergenic
1091652829 12:2322616-2322638 GAGGAACACCTGACTTTGGGAGG - Intronic
1094586210 12:31779786-31779808 GAGGTTCACCTGATTTTAGAGGG - Intergenic
1094741909 12:33299316-33299338 GAGGGTCACCTGAGTTTGGGAGG + Intergenic
1095817586 12:46441387-46441409 GAGGATCATCTGAGTCTGGGAGG - Intergenic
1099524827 12:83706109-83706131 GAGGCACTTCTGACTTTGGAAGG + Intergenic
1108785912 13:53901111-53901133 GAGGATCACCTGATTTCGGGAGG - Intergenic
1110172035 13:72512519-72512541 GTGATACTTCTTATTTTGGGAGG - Intergenic
1110334864 13:74315958-74315980 GGGGTACAAGTGATTTTGGTTGG - Intergenic
1114496173 14:23134028-23134050 GAGGATCATTTGAGTTTGGGAGG - Intronic
1115578701 14:34736891-34736913 GAGCTTCTTCTGAATTTGGGAGG + Intergenic
1115644445 14:35358387-35358409 GAGGTGCATGTGACTTTGGAGGG + Intergenic
1118079984 14:62347550-62347572 GATGTAGAGCTGATTCTGGGCGG + Intergenic
1118098665 14:62569754-62569776 GAGGAAAATGGGATTTTGGGTGG + Intergenic
1119814236 14:77550955-77550977 GTGGCACATCTGATTTTGGTTGG - Intronic
1120230341 14:81834913-81834935 GAGGATCACCTGACTTTGGGAGG - Intergenic
1123496635 15:20833565-20833587 GAGGTAGTTCTGGTTTGGGGTGG + Intergenic
1123553870 15:21407157-21407179 GAGGTAGTTCTGGTTTGGGGTGG + Intergenic
1123590114 15:21844522-21844544 GAGGTAGTTCTGGTTTGGGGTGG + Intergenic
1124434009 15:29632898-29632920 GGGGTACAGGTGATTTTGGACGG + Intergenic
1126229297 15:46306668-46306690 GAGGGACATGAGATTTTTGGGGG + Intergenic
1129505704 15:76079808-76079830 TAGGTAGATATGATTTAGGGCGG + Intronic
1202962216 15_KI270727v1_random:134353-134375 GAGGTAGTTCTGGTTTGGGGTGG + Intergenic
1132628956 16:907419-907441 GAAATACAACTGATTTTGTGTGG + Intronic
1134083243 16:11338967-11338989 GTGGAACATATGAATTTGGGAGG + Intronic
1135150078 16:19997921-19997943 GAGGTTCTGCTGATTTTGGCTGG + Intergenic
1138340779 16:56287701-56287723 AAGGGACAGCTGATTCTGGGAGG - Intronic
1141339550 16:83190226-83190248 GAAGTACATCTCATTATGAGTGG + Intronic
1141756572 16:85995280-85995302 GAAGTACATCTGGTTTTGGTTGG + Intergenic
1157023084 18:43809739-43809761 GGGGTACATCTGAATTTGCCGGG - Intergenic
1159724142 18:71932567-71932589 GAGGTACATCTGATTTTGGGGGG - Intergenic
1163895439 19:20054251-20054273 GAGGATCATCTGAGTTTGGGAGG + Intergenic
1163911041 19:20192677-20192699 GAGGATCATCTGAGTTTTGGAGG - Intronic
1163936979 19:20455608-20455630 GAGGAACATCTGAGTTTGGGAGG - Intergenic
1163955778 19:20638049-20638071 GAGGATAATCTGAGTTTGGGAGG + Intronic
1163960312 19:20683688-20683710 GAAGATCATCTGAGTTTGGGAGG - Intronic
1163971609 19:20801714-20801736 GAGGATCATCTGAGTTTGGGAGG - Intronic
1163974014 19:20831004-20831026 GAGGATCATCTGAGTTTGGGAGG + Intronic
1164103547 19:22081616-22081638 GAGGATCATCTGAGTTTGGGAGG - Intronic
1167312689 19:48746316-48746338 GAGGTTCAACAGGTTTTGGGGGG - Intronic
925491562 2:4400805-4400827 GAGGTACAACATAATTTGGGGGG - Intergenic
926027880 2:9560428-9560450 GATGAACAGATGATTTTGGGGGG + Intergenic
926993273 2:18703576-18703598 AAGATACATATGATTTAGGGAGG + Intergenic
927795342 2:26043263-26043285 CATGTACAGCTAATTTTGGGGGG - Intronic
930650027 2:53955079-53955101 GAGGAGCATCTGAGTCTGGGAGG + Intronic
931331146 2:61285395-61285417 GAGGAACACCTGAGTCTGGGAGG + Intronic
941263554 2:163329016-163329038 GAGGGAAAACTGGTTTTGGGGGG - Intergenic
941937336 2:170994837-170994859 GAGGTTCATCCTTTTTTGGGGGG + Intronic
942835400 2:180289944-180289966 GAGGAACATCTGAATTGGGTTGG + Intergenic
943353395 2:186821807-186821829 GAGGCACATGTTATTTTGTGAGG - Intergenic
943375830 2:187075456-187075478 AAGGCACATATGATTTTGTGTGG - Intergenic
944071342 2:195673264-195673286 GAGGATCATCTGAGCTTGGGTGG - Intronic
945272872 2:207959388-207959410 GAGGTTCAGATTATTTTGGGGGG + Intronic
945819220 2:214643167-214643189 GAAGTACATCATATTTGGGGCGG + Intergenic
948977001 2:241469802-241469824 GAGGTACATAGGACTTTGGAGGG + Intronic
1169959054 20:11138581-11138603 CAGGTGCATGTCATTTTGGGTGG + Intergenic
1170513501 20:17104024-17104046 GAGATGCATGTGATTTTGGTAGG - Intergenic
1172659485 20:36557768-36557790 GAGGATCATCTGAGTCTGGGAGG + Intergenic
1173272829 20:41554058-41554080 GAGGATCATCTGAGTCTGGGAGG + Intronic
1173748031 20:45452972-45452994 GAGGATCACCTGATTCTGGGAGG + Intergenic
1182120111 22:27781018-27781040 GAGGATCATCTGAGCTTGGGAGG - Intronic
1183464394 22:37972419-37972441 GAGTTACATGTGGATTTGGGGGG + Exonic
949368786 3:3311834-3311856 GAGGATCATCTGAGTCTGGGAGG + Intergenic
950756003 3:15173175-15173197 GAGGAACAGCTGATCTTGGCTGG - Intergenic
951204420 3:19910353-19910375 GAGGTTCCTCTGTCTTTGGGAGG + Intronic
953698345 3:45177361-45177383 GAGGATCATTTGATCTTGGGAGG + Intergenic
954211512 3:49100156-49100178 GAGGAGCATCTGGGTTTGGGTGG - Intronic
956096317 3:65720464-65720486 GAGGTTCATCAGAATTTGAGGGG - Intronic
956159965 3:66340304-66340326 GAGGTCCATATGAATTTTGGTGG + Intronic
961741785 3:129037761-129037783 CAGCCACATCTGATTTTAGGGGG - Intronic
962152673 3:132909636-132909658 GAGGATCACCTGCTTTTGGGAGG - Intergenic
963153522 3:142071803-142071825 GGGGGACAGCAGATTTTGGGAGG + Intronic
965075032 3:163964755-163964777 GAGGGACATGAGATTTTGGAGGG + Intergenic
966452481 3:180077909-180077931 GAGGTACATGAGATTTGGGAGGG - Intergenic
967286216 3:187873037-187873059 GAGGGACATTTGCTTTTGGAGGG + Intergenic
971933483 4:33117227-33117249 GAGAAACATCAGATTTTGGGGGG - Intergenic
975882877 4:78931664-78931686 GAGGTACATGTGCATTTGGAGGG + Intronic
976006518 4:80436704-80436726 GAGATAAAGATGATTTTGGGGGG + Intronic
978566585 4:110089044-110089066 TGGGTAGATCTGATTTTTGGAGG - Intronic
978589392 4:110308599-110308621 GAGGTACATGTGATATTTTGTGG - Intergenic
978971984 4:114819618-114819640 TAGATACATCTGATTATGTGGGG + Intergenic
979373143 4:119913720-119913742 GAGGTACATGAGATTTGTGGGGG - Intergenic
979513668 4:121582784-121582806 GAATTACCTTTGATTTTGGGTGG + Intergenic
984746596 4:183226184-183226206 GAGGATCATCTGAGTCTGGGAGG - Intronic
985858446 5:2449624-2449646 GAGGGAGGTGTGATTTTGGGCGG - Intergenic
987912737 5:24170051-24170073 GTAGTACATCTGATTTGTGGAGG - Intronic
988001544 5:25356033-25356055 CAGATAAATCTGATTTTTGGAGG + Intergenic
988628216 5:32900224-32900246 AAGGTACATGAGATTTTGGAGGG - Intergenic
990577897 5:57141078-57141100 GAGGATCATCTGAGCTTGGGAGG - Intergenic
991085372 5:62644123-62644145 GAAGAACGTCTCATTTTGGGAGG - Intergenic
992006811 5:72486462-72486484 GAGGTACACAGGATGTTGGGAGG - Intronic
992657570 5:78925611-78925633 GAGGTATATCTCATTTTTAGGGG - Intronic
995577609 5:113557702-113557724 GAGGATCATCTGATCCTGGGAGG + Intronic
999072615 5:148762613-148762635 GAGGTTCATCTGAGCCTGGGAGG - Intergenic
1000971686 5:167721877-167721899 TAGGTTTTTCTGATTTTGGGGGG - Intronic
1003468675 6:6407595-6407617 GATGTACATCTGTTATTGCGTGG - Intergenic
1005489097 6:26330250-26330272 GAGGTAGATCTATTTTTGGAAGG + Intergenic
1006524500 6:34592106-34592128 GATGTCCTTCTGGTTTTGGGAGG - Intronic
1010539038 6:77068997-77069019 AAGGGACATGAGATTTTGGGAGG - Intergenic
1013901890 6:115166498-115166520 GAGTTAAATCTGTATTTGGGAGG - Intergenic
1015847760 6:137538772-137538794 CAGATACATCTGATTTTTGAAGG - Intergenic
1016978855 6:149835516-149835538 GAGGATCATGTGAGTTTGGGAGG + Intronic
1020179396 7:5909786-5909808 GAGGTAAATCTGAATTTACGTGG - Intronic
1020303540 7:6815072-6815094 GAGGTAAATCTGAATTTACGTGG + Intronic
1021739720 7:23674036-23674058 GAGGTACATGTGATATTTCGAGG + Intergenic
1023131337 7:37006091-37006113 GCAGTACATCTGTTTGTGGGTGG + Intronic
1024571337 7:50725118-50725140 GATGGACATGAGATTTTGGGCGG - Intronic
1025867331 7:65396002-65396024 GAAGATCATCTGAGTTTGGGAGG - Intronic
1026628681 7:72018924-72018946 GAGAATCATCTGATTCTGGGAGG - Intronic
1031772066 7:125856643-125856665 GAGATACTTGTGATTTTGTGGGG - Intergenic
1032205560 7:129862050-129862072 GAGGTTCCTCTGATTTTAGGGGG - Intronic
1032341611 7:131079214-131079236 AAGTTGCATGTGATTTTGGGAGG - Intergenic
1033125668 7:138704989-138705011 GAGGAACATTTGAGCTTGGGAGG + Intergenic
1033841112 7:145374423-145374445 GAAGTACATATTATTTGGGGTGG - Intergenic
1036715258 8:11116724-11116746 GGGGGACATCTGAGTTCGGGAGG - Intronic
1038418698 8:27418011-27418033 GAGGGACATCTGGTTGGGGGAGG - Intronic
1039282481 8:36001134-36001156 AAGGAGCATCTGATTTTTGGTGG + Intergenic
1039365672 8:36925676-36925698 GGGGACCATTTGATTTTGGGTGG + Intronic
1042526285 8:69768141-69768163 GAGGATCACCTGAGTTTGGGAGG + Intronic
1042560198 8:70068210-70068232 GAGGTAAATCTGTTTCTGGTGGG - Exonic
1043175479 8:77019105-77019127 GAGGTTCAGCTGATTTGGGTTGG - Intergenic
1043476279 8:80608865-80608887 TTGGTCCATTTGATTTTGGGAGG + Intergenic
1046053769 8:109055386-109055408 GGGGTACATCTGTTTATGGATGG - Intergenic
1048138573 8:131770622-131770644 GAGCTTCATGTGAATTTGGGAGG + Intergenic
1053165888 9:35843386-35843408 GAGGTTCTTCAGCTTTTGGGTGG - Intronic
1056131429 9:83590656-83590678 GAAGTACATCTTATTTAGGCTGG - Intergenic
1059142429 9:111866072-111866094 GAGGATCATCTGAGTCTGGGAGG + Intergenic
1189025233 X:37387746-37387768 GAGGGACATGTGATTTGTGGGGG - Intronic
1190069585 X:47268629-47268651 GAGGATCATCTGAGTCTGGGAGG + Intergenic
1190077272 X:47326642-47326664 GAGGATCATCTGAGTCTGGGAGG - Intergenic
1190606963 X:52153593-52153615 GAGATACATCTGAATATGTGGGG + Intergenic
1192443804 X:71195107-71195129 GAGGATCATCTGAGTCTGGGAGG - Intergenic
1196282538 X:113839525-113839547 TGGGTACATTTTATTTTGGGGGG + Intergenic
1199261542 X:145780576-145780598 GAGGGACATGAGATTTTGGGAGG + Intergenic
1199717679 X:150517826-150517848 GAGATATATATGGTTTTGGGGGG + Intergenic