ID: 1159730659

View in Genome Browser
Species Human (GRCh38)
Location 18:72023135-72023157
Sequence ATGTGTGAGTTGGGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159730659_1159730665 -9 Left 1159730659 18:72023135-72023157 CCCTCTTCCCCCAACTCACACAT No data
Right 1159730665 18:72023149-72023171 CTCACACATTTCCTAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159730659 Original CRISPR ATGTGTGAGTTGGGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr