ID: 1159730867

View in Genome Browser
Species Human (GRCh38)
Location 18:72025852-72025874
Sequence ACTTATATATTGAAGGTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159730867_1159730869 -3 Left 1159730867 18:72025852-72025874 CCTTTTACCTTCAATATATAAGT No data
Right 1159730869 18:72025872-72025894 AGTGTCTTTATTAGTTGTGTAGG No data
1159730867_1159730871 29 Left 1159730867 18:72025852-72025874 CCTTTTACCTTCAATATATAAGT No data
Right 1159730871 18:72025904-72025926 AGCAGCATATGATTGGATCAAGG No data
1159730867_1159730870 22 Left 1159730867 18:72025852-72025874 CCTTTTACCTTCAATATATAAGT No data
Right 1159730870 18:72025897-72025919 ACTTCTAAGCAGCATATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159730867 Original CRISPR ACTTATATATTGAAGGTAAA AGG (reversed) Intergenic
No off target data available for this crispr