ID: 1159733536

View in Genome Browser
Species Human (GRCh38)
Location 18:72063293-72063315
Sequence CTAATTCAGCACATTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159733536_1159733538 6 Left 1159733536 18:72063293-72063315 CCAATGTCAATGTGCTGAATTAG No data
Right 1159733538 18:72063322-72063344 AATGAACGCCTGAAGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159733536 Original CRISPR CTAATTCAGCACATTGACAT TGG (reversed) Intergenic
No off target data available for this crispr