ID: 1159734171

View in Genome Browser
Species Human (GRCh38)
Location 18:72073791-72073813
Sequence CAGCTGCCCAGAAGACCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159734171_1159734174 -4 Left 1159734171 18:72073791-72073813 CCCACTGGTCTTCTGGGCAGCTG No data
Right 1159734174 18:72073810-72073832 GCTGCCTGCATGGACCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159734171 Original CRISPR CAGCTGCCCAGAAGACCAGT GGG (reversed) Intergenic
No off target data available for this crispr