ID: 1159739019

View in Genome Browser
Species Human (GRCh38)
Location 18:72141736-72141758
Sequence GGGTGATCACTACTGCTATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159739019_1159739027 7 Left 1159739019 18:72141736-72141758 CCCAATAGCAGTAGTGATCACCC No data
Right 1159739027 18:72141766-72141788 TGAAAGGGCACCGTCCCTGAGGG No data
1159739019_1159739026 6 Left 1159739019 18:72141736-72141758 CCCAATAGCAGTAGTGATCACCC No data
Right 1159739026 18:72141765-72141787 CTGAAAGGGCACCGTCCCTGAGG No data
1159739019_1159739022 -8 Left 1159739019 18:72141736-72141758 CCCAATAGCAGTAGTGATCACCC No data
Right 1159739022 18:72141751-72141773 GATCACCCTGAGACCTGAAAGGG No data
1159739019_1159739021 -9 Left 1159739019 18:72141736-72141758 CCCAATAGCAGTAGTGATCACCC No data
Right 1159739021 18:72141750-72141772 TGATCACCCTGAGACCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159739019 Original CRISPR GGGTGATCACTACTGCTATT GGG (reversed) Intergenic
No off target data available for this crispr