ID: 1159739021

View in Genome Browser
Species Human (GRCh38)
Location 18:72141750-72141772
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159739020_1159739021 -10 Left 1159739020 18:72141737-72141759 CCAATAGCAGTAGTGATCACCCT No data
Right 1159739021 18:72141750-72141772 TGATCACCCTGAGACCTGAAAGG No data
1159739018_1159739021 9 Left 1159739018 18:72141718-72141740 CCAATGTGAATGCTATATCCCAA No data
Right 1159739021 18:72141750-72141772 TGATCACCCTGAGACCTGAAAGG No data
1159739019_1159739021 -9 Left 1159739019 18:72141736-72141758 CCCAATAGCAGTAGTGATCACCC No data
Right 1159739021 18:72141750-72141772 TGATCACCCTGAGACCTGAAAGG No data
1159739017_1159739021 17 Left 1159739017 18:72141710-72141732 CCATCTAACCAATGTGAATGCTA No data
Right 1159739021 18:72141750-72141772 TGATCACCCTGAGACCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159739021 Original CRISPR TGATCACCCTGAGACCTGAA AGG Intergenic
No off target data available for this crispr