ID: 1159739027

View in Genome Browser
Species Human (GRCh38)
Location 18:72141766-72141788
Sequence TGAAAGGGCACCGTCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159739019_1159739027 7 Left 1159739019 18:72141736-72141758 CCCAATAGCAGTAGTGATCACCC No data
Right 1159739027 18:72141766-72141788 TGAAAGGGCACCGTCCCTGAGGG No data
1159739020_1159739027 6 Left 1159739020 18:72141737-72141759 CCAATAGCAGTAGTGATCACCCT No data
Right 1159739027 18:72141766-72141788 TGAAAGGGCACCGTCCCTGAGGG No data
1159739018_1159739027 25 Left 1159739018 18:72141718-72141740 CCAATGTGAATGCTATATCCCAA No data
Right 1159739027 18:72141766-72141788 TGAAAGGGCACCGTCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159739027 Original CRISPR TGAAAGGGCACCGTCCCTGA GGG Intergenic
No off target data available for this crispr