ID: 1159740442

View in Genome Browser
Species Human (GRCh38)
Location 18:72161763-72161785
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159740440_1159740442 -3 Left 1159740440 18:72161743-72161765 CCTATTTTATTGTGGATTTGTAT No data
Right 1159740442 18:72161763-72161785 TATTGTGGATGTTCAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159740442 Original CRISPR TATTGTGGATGTTCAACAAA AGG Intergenic
No off target data available for this crispr