ID: 1159742990

View in Genome Browser
Species Human (GRCh38)
Location 18:72196456-72196478
Sequence GGAAGTTTAGTTAAATTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159742990_1159743002 25 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG No data
1159742990_1159742992 0 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159742992 18:72196479-72196501 AGCTGTGCCAATCTAAAACTTGG No data
1159742990_1159743001 24 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159743001 18:72196503-72196525 CCTGAATAAGGAAAAGGGGGAGG No data
1159742990_1159742996 19 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159742996 18:72196498-72196520 TTGGCCCTGAATAAGGAAAAGGG No data
1159742990_1159742997 20 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159742997 18:72196499-72196521 TGGCCCTGAATAAGGAAAAGGGG No data
1159742990_1159742998 21 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159742998 18:72196500-72196522 GGCCCTGAATAAGGAAAAGGGGG No data
1159742990_1159742994 12 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159742994 18:72196491-72196513 CTAAAACTTGGCCCTGAATAAGG No data
1159742990_1159742995 18 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159742995 18:72196497-72196519 CTTGGCCCTGAATAAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159742990 Original CRISPR GGAAGTTTAGTTAAATTCAG AGG (reversed) Intergenic
No off target data available for this crispr