ID: 1159742993

View in Genome Browser
Species Human (GRCh38)
Location 18:72196486-72196508
Sequence TTCAGGGCCAAGTTTTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159742993_1159742998 -9 Left 1159742993 18:72196486-72196508 CCAATCTAAAACTTGGCCCTGAA No data
Right 1159742998 18:72196500-72196522 GGCCCTGAATAAGGAAAAGGGGG No data
1159742993_1159743001 -6 Left 1159742993 18:72196486-72196508 CCAATCTAAAACTTGGCCCTGAA No data
Right 1159743001 18:72196503-72196525 CCTGAATAAGGAAAAGGGGGAGG No data
1159742993_1159743002 -5 Left 1159742993 18:72196486-72196508 CCAATCTAAAACTTGGCCCTGAA No data
Right 1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG No data
1159742993_1159742997 -10 Left 1159742993 18:72196486-72196508 CCAATCTAAAACTTGGCCCTGAA No data
Right 1159742997 18:72196499-72196521 TGGCCCTGAATAAGGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159742993 Original CRISPR TTCAGGGCCAAGTTTTAGAT TGG (reversed) Intergenic
No off target data available for this crispr