ID: 1159743002

View in Genome Browser
Species Human (GRCh38)
Location 18:72196504-72196526
Sequence CTGAATAAGGAAAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159742993_1159743002 -5 Left 1159742993 18:72196486-72196508 CCAATCTAAAACTTGGCCCTGAA No data
Right 1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG No data
1159742990_1159743002 25 Left 1159742990 18:72196456-72196478 CCTCTGAATTTAACTAAACTTCC No data
Right 1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG No data
1159742989_1159743002 28 Left 1159742989 18:72196453-72196475 CCTCCTCTGAATTTAACTAAACT No data
Right 1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG No data
1159742991_1159743002 4 Left 1159742991 18:72196477-72196499 CCAGCTGTGCCAATCTAAAACTT No data
Right 1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159743002 Original CRISPR CTGAATAAGGAAAAGGGGGA GGG Intergenic
No off target data available for this crispr