ID: 1159746876

View in Genome Browser
Species Human (GRCh38)
Location 18:72247369-72247391
Sequence CTGTTTATGCAAATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159746870_1159746876 -1 Left 1159746870 18:72247347-72247369 CCTTCCAGGTTCCCAGTCAGGTC No data
Right 1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG No data
1159746871_1159746876 -5 Left 1159746871 18:72247351-72247373 CCAGGTTCCCAGTCAGGTCTGTT No data
Right 1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159746876 Original CRISPR CTGTTTATGCAAATGGAGGA TGG Intergenic
No off target data available for this crispr