ID: 1159747590

View in Genome Browser
Species Human (GRCh38)
Location 18:72257091-72257113
Sequence TCCTCTCTGTCTTCTTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159747590_1159747591 14 Left 1159747590 18:72257091-72257113 CCAGCTCAAGAAGACAGAGAGGA No data
Right 1159747591 18:72257128-72257150 ATCTTTTTTTTTTTTTTATTTGG No data
1159747590_1159747593 29 Left 1159747590 18:72257091-72257113 CCAGCTCAAGAAGACAGAGAGGA No data
Right 1159747593 18:72257143-72257165 TTATTTGGCCCTCTGTGGATTGG No data
1159747590_1159747592 24 Left 1159747590 18:72257091-72257113 CCAGCTCAAGAAGACAGAGAGGA No data
Right 1159747592 18:72257138-72257160 TTTTTTTATTTGGCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159747590 Original CRISPR TCCTCTCTGTCTTCTTGAGC TGG (reversed) Intergenic