ID: 1159747591

View in Genome Browser
Species Human (GRCh38)
Location 18:72257128-72257150
Sequence ATCTTTTTTTTTTTTTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78475
Summary {0: 2, 1: 140, 2: 2113, 3: 22843, 4: 53377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159747590_1159747591 14 Left 1159747590 18:72257091-72257113 CCAGCTCAAGAAGACAGAGAGGA No data
Right 1159747591 18:72257128-72257150 ATCTTTTTTTTTTTTTTATTTGG 0: 2
1: 140
2: 2113
3: 22843
4: 53377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159747591 Original CRISPR ATCTTTTTTTTTTTTTTATT TGG Intergenic
Too many off-targets to display for this crispr