ID: 1159747592

View in Genome Browser
Species Human (GRCh38)
Location 18:72257138-72257160
Sequence TTTTTTTATTTGGCCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159747590_1159747592 24 Left 1159747590 18:72257091-72257113 CCAGCTCAAGAAGACAGAGAGGA No data
Right 1159747592 18:72257138-72257160 TTTTTTTATTTGGCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159747592 Original CRISPR TTTTTTTATTTGGCCCTCTG TGG Intergenic
No off target data available for this crispr