ID: 1159747593

View in Genome Browser
Species Human (GRCh38)
Location 18:72257143-72257165
Sequence TTATTTGGCCCTCTGTGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159747590_1159747593 29 Left 1159747590 18:72257091-72257113 CCAGCTCAAGAAGACAGAGAGGA No data
Right 1159747593 18:72257143-72257165 TTATTTGGCCCTCTGTGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159747593 Original CRISPR TTATTTGGCCCTCTGTGGAT TGG Intergenic
No off target data available for this crispr