ID: 1159754519

View in Genome Browser
Species Human (GRCh38)
Location 18:72348052-72348074
Sequence GGCACTCCTGTGTTTCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159754519_1159754528 26 Left 1159754519 18:72348052-72348074 CCGGGCAGAAACACAGGAGTGCC No data
Right 1159754528 18:72348101-72348123 TTTACTGTGCTGGCCCTGGAAGG No data
1159754519_1159754526 22 Left 1159754519 18:72348052-72348074 CCGGGCAGAAACACAGGAGTGCC No data
Right 1159754526 18:72348097-72348119 TTCCTTTACTGTGCTGGCCCTGG No data
1159754519_1159754525 16 Left 1159754519 18:72348052-72348074 CCGGGCAGAAACACAGGAGTGCC No data
Right 1159754525 18:72348091-72348113 CTTCTTTTCCTTTACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159754519 Original CRISPR GGCACTCCTGTGTTTCTGCC CGG (reversed) Intergenic
No off target data available for this crispr