ID: 1159756780

View in Genome Browser
Species Human (GRCh38)
Location 18:72375705-72375727
Sequence ACACATAAACTCCAGTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159756777_1159756780 1 Left 1159756777 18:72375681-72375703 CCTCTCTGACCCATTAACTGAGT No data
Right 1159756780 18:72375705-72375727 ACACATAAACTCCAGTTGTGTGG No data
1159756778_1159756780 -8 Left 1159756778 18:72375690-72375712 CCCATTAACTGAGTAACACATAA No data
Right 1159756780 18:72375705-72375727 ACACATAAACTCCAGTTGTGTGG No data
1159756779_1159756780 -9 Left 1159756779 18:72375691-72375713 CCATTAACTGAGTAACACATAAA No data
Right 1159756780 18:72375705-72375727 ACACATAAACTCCAGTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159756780 Original CRISPR ACACATAAACTCCAGTTGTG TGG Intergenic
No off target data available for this crispr