ID: 1159757438

View in Genome Browser
Species Human (GRCh38)
Location 18:72383070-72383092
Sequence GTTGGTGTGAAATGTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159757434_1159757438 16 Left 1159757434 18:72383031-72383053 CCTTGGAGAAGGTACAAAAAAGC No data
Right 1159757438 18:72383070-72383092 GTTGGTGTGAAATGTGAGAAAGG No data
1159757433_1159757438 17 Left 1159757433 18:72383030-72383052 CCCTTGGAGAAGGTACAAAAAAG No data
Right 1159757438 18:72383070-72383092 GTTGGTGTGAAATGTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159757438 Original CRISPR GTTGGTGTGAAATGTGAGAA AGG Intergenic
No off target data available for this crispr