ID: 1159764516

View in Genome Browser
Species Human (GRCh38)
Location 18:72471700-72471722
Sequence CTAATTTACAAGCACTACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159764514_1159764516 29 Left 1159764514 18:72471648-72471670 CCTTAAGTTATGCAAAATCATAT No data
Right 1159764516 18:72471700-72471722 CTAATTTACAAGCACTACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159764516 Original CRISPR CTAATTTACAAGCACTACAC AGG Intergenic
No off target data available for this crispr