ID: 1159769559

View in Genome Browser
Species Human (GRCh38)
Location 18:72532975-72532997
Sequence CTGAGGCTATCCTAGCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159769559_1159769563 3 Left 1159769559 18:72532975-72532997 CCATTTTGCTAGGATAGCCTCAG No data
Right 1159769563 18:72533001-72533023 AAAGCAGCATTCTAACCCTGGGG No data
1159769559_1159769564 17 Left 1159769559 18:72532975-72532997 CCATTTTGCTAGGATAGCCTCAG No data
Right 1159769564 18:72533015-72533037 ACCCTGGGGAGTCCTGCTGTAGG No data
1159769559_1159769562 2 Left 1159769559 18:72532975-72532997 CCATTTTGCTAGGATAGCCTCAG No data
Right 1159769562 18:72533000-72533022 CAAAGCAGCATTCTAACCCTGGG No data
1159769559_1159769569 29 Left 1159769559 18:72532975-72532997 CCATTTTGCTAGGATAGCCTCAG No data
Right 1159769569 18:72533027-72533049 CCTGCTGTAGGCATTAAGAAGGG No data
1159769559_1159769561 1 Left 1159769559 18:72532975-72532997 CCATTTTGCTAGGATAGCCTCAG No data
Right 1159769561 18:72532999-72533021 GCAAAGCAGCATTCTAACCCTGG No data
1159769559_1159769567 28 Left 1159769559 18:72532975-72532997 CCATTTTGCTAGGATAGCCTCAG No data
Right 1159769567 18:72533026-72533048 TCCTGCTGTAGGCATTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159769559 Original CRISPR CTGAGGCTATCCTAGCAAAA TGG (reversed) Intergenic
No off target data available for this crispr