ID: 1159771550

View in Genome Browser
Species Human (GRCh38)
Location 18:72551572-72551594
Sequence ACATATAGACTTCAGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159771550_1159771554 -9 Left 1159771550 18:72551572-72551594 CCCCATCACTGAAGTCTATATGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1159771554 18:72551586-72551608 TCTATATGTCTGCATGGAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 152
1159771550_1159771556 4 Left 1159771550 18:72551572-72551594 CCCCATCACTGAAGTCTATATGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1159771556 18:72551599-72551621 ATGGAGCTGGACTAATGTGTGGG 0: 1
1: 0
2: 1
3: 3
4: 111
1159771550_1159771557 24 Left 1159771550 18:72551572-72551594 CCCCATCACTGAAGTCTATATGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1159771557 18:72551619-72551641 GGGTCTCTGTGTGTATACACAGG 0: 1
1: 0
2: 2
3: 21
4: 257
1159771550_1159771559 30 Left 1159771550 18:72551572-72551594 CCCCATCACTGAAGTCTATATGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1159771559 18:72551625-72551647 CTGTGTGTATACACAGGTGAGGG 0: 1
1: 0
2: 1
3: 31
4: 242
1159771550_1159771555 3 Left 1159771550 18:72551572-72551594 CCCCATCACTGAAGTCTATATGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1159771555 18:72551598-72551620 CATGGAGCTGGACTAATGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 123
1159771550_1159771558 29 Left 1159771550 18:72551572-72551594 CCCCATCACTGAAGTCTATATGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1159771558 18:72551624-72551646 TCTGTGTGTATACACAGGTGAGG 0: 1
1: 0
2: 7
3: 51
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159771550 Original CRISPR ACATATAGACTTCAGTGATG GGG (reversed) Intronic
904958013 1:34304531-34304553 ATATATAGATTTCAGTTATTAGG - Intergenic
911589926 1:99735330-99735352 ACATTTTGATTTTAGTGATGAGG + Intronic
912164485 1:107026333-107026355 ACATTTTGACTACAGTGATATGG - Intergenic
914722099 1:150297692-150297714 GCACATAGAATTAAGTGATGTGG - Intronic
918379415 1:183939397-183939419 ACATCTGGACAGCAGTGATGGGG + Intronic
918603554 1:186393222-186393244 ACAGATAAACTTCAGTCATGGGG - Intronic
919117924 1:193304663-193304685 AGAGATACATTTCAGTGATGGGG + Intergenic
922126329 1:222728330-222728352 TCACATAAAATTCAGTGATGGGG + Intronic
922476853 1:225912338-225912360 CCATATAGCCTGCAGTGGTGTGG - Intronic
923042752 1:230331514-230331536 ACTTCCAGACTCCAGTGATGAGG - Intronic
924241245 1:242043252-242043274 ACATAAAGACTCCTCTGATGGGG + Intergenic
1063007598 10:1988384-1988406 ACATATGTATTTCAATGATGTGG - Intergenic
1067852091 10:49760791-49760813 ACATATTGACTGCAGTGATCAGG - Intronic
1068253383 10:54473046-54473068 ACAGATAGACCTCAGTGAGGTGG + Intronic
1074492537 10:113952046-113952068 ACAGAGAGACACCAGTGATGCGG - Intergenic
1075959866 10:126559010-126559032 AGAGATGGACTTCAGTGATGTGG - Intronic
1079050111 11:17147483-17147505 ACAAATGGAATTCAGTTATGAGG + Intronic
1085059760 11:73434311-73434333 ACATAAAGTCTTCAGTGCTATGG + Intronic
1087337828 11:96866549-96866571 ACATATGGTCTTCAGTGATCTGG + Intergenic
1087430400 11:98046300-98046322 TGAGATCGACTTCAGTGATGGGG - Intergenic
1089073021 11:115715966-115715988 AAATGAAGACTTCAGTGAAGAGG - Intergenic
1091115518 11:133009054-133009076 ACATGTAGACTTAAGTAATCTGG - Intronic
1097191362 12:57221086-57221108 AGATATAGAGTACAGGGATGAGG - Intronic
1098467957 12:70809543-70809565 AGATATAGAATTTAGTGAAGAGG - Intronic
1099280953 12:80645565-80645587 TCATATATACTTCAGGGCTGGGG - Intronic
1099355498 12:81629859-81629881 ACATACAGGCTTCAGGGATTAGG - Intronic
1099847935 12:88053046-88053068 ACATACACACTTTAGTGAGGAGG + Intronic
1100665140 12:96743427-96743449 CCATACACACTTCATTGATGAGG - Exonic
1102380886 12:112465868-112465890 AGAAATAGTTTTCAGTGATGAGG + Intronic
1104705992 12:130947975-130947997 ACGGATAGACTTCAGGGATCAGG - Intergenic
1106631269 13:31476933-31476955 ACGTATAAACTTCAGTCACGTGG + Intergenic
1107803139 13:44129472-44129494 ACGAATAGATTTCAGGGATGAGG - Intergenic
1109801927 13:67391135-67391157 ACACATACACTTCAGAGATAGGG + Intergenic
1109836134 13:67859401-67859423 ATATATAGAATACAGTGATATGG + Intergenic
1109851321 13:68068223-68068245 ATATAGTGACTTCAGTGCTGAGG - Intergenic
1110621438 13:77600127-77600149 AGAAAGAGACTTCAGTGGTGAGG - Intronic
1111265769 13:85810896-85810918 ACAAATATATTTCAGTGATTAGG - Intergenic
1112904645 13:104401650-104401672 ATATACAAACTTCAGTGATCAGG + Intergenic
1113094691 13:106651243-106651265 ACATATATTCTTCACTCATGTGG + Intergenic
1114473536 14:22979602-22979624 ACATTTTGAATTCAGAGATGGGG - Intronic
1116995917 14:51323921-51323943 ACATTTAGAATTCTGAGATGAGG - Intergenic
1117323632 14:54648306-54648328 AGATTGAGACTTCAGTGCTGGGG + Intronic
1117667618 14:58073328-58073350 GCAGATTGACTTTAGTGATGAGG - Intronic
1118291680 14:64530729-64530751 ACTAATTGACTTCAGTGATTTGG - Intronic
1120398100 14:83993661-83993683 ACATATTGACTCCAGAGGTGAGG + Intergenic
1124415985 15:29473613-29473635 AAAGATAGACTTCAGTGCTCAGG + Intronic
1126417678 15:48434835-48434857 ACATCCAGACTGCAGTGCTGTGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127925757 15:63539141-63539163 ACTTATATACTAGAGTGATGTGG + Intronic
1131109195 15:89754108-89754130 ACATATAAAATACAGTAATGAGG + Intergenic
1131904881 15:97132416-97132438 AGATAGAGATTTGAGTGATGTGG - Intergenic
1135282370 16:21163695-21163717 ACAAATAAATTTCAGTGAGGAGG + Intronic
1135285539 16:21189613-21189635 ACAGAAAGACTGCAGTGCTGGGG + Intergenic
1137602051 16:49762874-49762896 ACATTTTCATTTCAGTGATGTGG - Intronic
1138075078 16:54034142-54034164 ACATATACCTTTCAGTAATGGGG - Intronic
1140944691 16:79756995-79757017 ACATAAAGATTTCAGTGTAGGGG + Intergenic
1141371761 16:83493613-83493635 ACTTAAAGACTCCAGAGATGAGG + Intronic
1145874721 17:28308490-28308512 ATAAATAAAATTCAGTGATGGGG + Intergenic
1146138919 17:30347998-30348020 AAATATAGATATCAATGATGTGG + Intergenic
1150537445 17:66057791-66057813 ACACACAGCCTTCAGTGAGGGGG + Intronic
1150848396 17:68681884-68681906 ACATCTTGACTTCAATAATGTGG - Intergenic
1155561181 18:27078905-27078927 AGATATAGAATTCATTAATGAGG + Intronic
1156982804 18:43311124-43311146 ACAAATAAACAGCAGTGATGTGG - Intergenic
1158702334 18:59759861-59759883 TCATCTAGACTGCAGTGAAGTGG - Intergenic
1159771550 18:72551572-72551594 ACATATAGACTTCAGTGATGGGG - Intronic
1160449904 18:78955446-78955468 ACGTCTAGACCTCAGTGAGGTGG - Intergenic
1164878975 19:31714903-31714925 ACAATTAGAGCTCAGTGATGGGG + Intergenic
1168331392 19:55571712-55571734 ACATATAGACTTCATCCATTTGG - Intergenic
926651413 2:15350615-15350637 ACATATAGACTTAATTGGTTCGG + Intronic
931281411 2:60796178-60796200 AAATCTAGACTTCTGTAATGGGG - Intronic
933330971 2:80892798-80892820 AAATATAGAATTAAATGATGAGG + Intergenic
935219173 2:100997508-100997530 ACACTTAGATATCAGTGATGTGG + Intergenic
935920198 2:108004329-108004351 GAATATAGACTTCAGGAATGGGG + Intronic
936511824 2:113154418-113154440 AGATATCGCCTTCATTGATGTGG + Intergenic
936767798 2:115874894-115874916 ACCTTTAGACTTCAGTGTTTTGG - Intergenic
937833523 2:126448271-126448293 ACATATTCACTTCAGTAAAGAGG - Intergenic
939770165 2:146305984-146306006 ACAAATGGACTTCATAGATGGGG - Intergenic
942367873 2:175247778-175247800 AAAGAAAGACTTCATTGATGTGG + Intergenic
943171038 2:184400595-184400617 ATATAAAGACTACAGTGCTGTGG - Intergenic
1169252162 20:4069082-4069104 ACACACAGCCTTCAGTGCTGAGG - Intergenic
1169984426 20:11427225-11427247 ACATCTAGAGGTTAGTGATGAGG - Intergenic
1171494309 20:25544636-25544658 AAATACAGACTCCAGTGTTGTGG - Intronic
1173936710 20:46872604-46872626 AAATAGAGAATTCACTGATGAGG - Intergenic
1179073544 21:38095852-38095874 GCATTTAGACTTCTGAGATGAGG + Intronic
950516241 3:13467468-13467490 TCATATTGATATCAGTGATGAGG - Intergenic
950674280 3:14545243-14545265 ACATCTCCACTTCAGAGATGAGG + Intergenic
951062023 3:18220118-18220140 ACATGCAAACTGCAGTGATGTGG - Intronic
951655574 3:25004177-25004199 ACATATGGCTATCAGTGATGTGG - Intergenic
952032254 3:29157574-29157596 ACATCTAGTCCTCAGTGCTGAGG + Intergenic
953503347 3:43459412-43459434 ACAGATAGTCTTCTGTGAAGAGG + Intronic
954041747 3:47893217-47893239 ATTTAAAGACTTCAGTGATCAGG + Intronic
959209289 3:103356358-103356380 ACTTAAAAACTTCAGTGATATGG - Intergenic
964162078 3:153657641-153657663 ACATACTGACTTCAGTCAGGTGG + Intergenic
964448990 3:156791805-156791827 ACATGTAGACTTCAGATAAGGGG + Intergenic
970499162 4:16659362-16659384 TCATGTTGACTTCAGTGGTGAGG - Intronic
972213549 4:36868196-36868218 ACATATAGGCTTCAGGGAGAAGG - Intergenic
975741591 4:77434590-77434612 GCATAGAGACTTCAGTTCTGAGG - Intergenic
977048733 4:92099683-92099705 CCATATAGTCTTCATTGATCTGG + Intergenic
979807633 4:124994458-124994480 ACATAAAGAATTCAGTGAATGGG + Intergenic
982034774 4:151334844-151334866 ACTTCTAGACTTCATTTATGGGG + Intergenic
983038902 4:162901025-162901047 AAATCTAGACTTCAGAGAAGTGG - Intergenic
983632057 4:169859624-169859646 ACATATAAACAACAGTGAGGTGG - Intergenic
984459939 4:180021399-180021421 ACAGAAAAACTTCAGTGATGTGG + Intergenic
984816345 4:183840785-183840807 ACAAAAAAAGTTCAGTGATGTGG + Intergenic
986897604 5:12389202-12389224 ACATACAAACTTCAGGGAGGGGG - Intergenic
988133106 5:27132263-27132285 ACATTTATAAATCAGTGATGAGG - Intergenic
988149718 5:27362172-27362194 ATAAATAGACCTTAGTGATGTGG - Intergenic
988310773 5:29554766-29554788 ACATCTATACTTCAGGAATGAGG - Intergenic
990479310 5:56192922-56192944 AAATAAAGACTTCCGTGCTGTGG + Intronic
994793626 5:104264731-104264753 ACATATATACTACTTTGATGGGG + Intergenic
996695240 5:126387138-126387160 AAATATGGACTTCAGTCATATGG - Intronic
999543718 5:152603435-152603457 ACATATAGAATTCATTTATGTGG + Intergenic
999545231 5:152621902-152621924 ACATACAGACTTCTGGGCTGTGG - Intergenic
1001136853 5:169109794-169109816 CCATATTGACTTCACTCATGAGG + Intronic
1003856640 6:10282934-10282956 ATATATACATTTCAGGGATGTGG + Intergenic
1004049815 6:12065486-12065508 ACACATAGAATACAGGGATGTGG + Intronic
1004532455 6:16465852-16465874 ACATAAAGACATGAGAGATGGGG + Intronic
1008316213 6:50044816-50044838 ACTTACAGACATCAGTGATAAGG - Intronic
1010013874 6:71081887-71081909 ACATCTAGAATTCAGGCATGGGG + Intergenic
1010705102 6:79099040-79099062 TTATATAGACTTCAGTGACAGGG + Intergenic
1010942420 6:81934294-81934316 AAATGTAAACTTTAGTGATGTGG + Intergenic
1012784704 6:103608968-103608990 ATATATATCCTCCAGTGATGTGG - Intergenic
1013443895 6:110201330-110201352 ACATATAGATTTGAGTGAGAGGG + Intronic
1013492662 6:110664242-110664264 AAATAGAGACTTGGGTGATGAGG - Intronic
1015402481 6:132801754-132801776 AAACAGAGACTACAGTGATGTGG - Intergenic
1016285679 6:142469978-142470000 ATTTATAGATTTCAGTGATTAGG + Intergenic
1018434908 6:163751054-163751076 ACATAAATACTTCAATTATGGGG - Intergenic
1020747124 7:12092017-12092039 ACATATCCACTTTAGTGAAGTGG + Intergenic
1023613007 7:41990489-41990511 AGAATCAGACTTCAGTGATGTGG - Intronic
1024356877 7:48422719-48422741 ACTTACAGGCTTCAGTGATAAGG - Intronic
1028300080 7:89188109-89188131 ACATGTAGACTTGTTTGATGCGG - Intronic
1030973276 7:116088751-116088773 ACATATATATTTCAGTTATCAGG - Intronic
1033080147 7:138288781-138288803 ACATAAAGACTTCTTTGAAGGGG - Intergenic
1039291865 8:36104554-36104576 ACAAAAAGACTTCAGTGAACTGG + Intergenic
1039809964 8:41037944-41037966 AAATATTGATTTCACTGATGTGG + Intergenic
1041054195 8:53965662-53965684 ACATATAGGTTTAAGTGATTGGG + Intergenic
1042315674 8:67423690-67423712 AGAAAAAGACTTCAGTAATGAGG - Intronic
1044362281 8:91300872-91300894 ACATATAAACTTTATTCATGAGG - Intronic
1044878839 8:96701330-96701352 ACATATAGACCTCTGAAATGGGG + Intronic
1046493964 8:114989412-114989434 ACATTTAGACTTCAGTGGTTAGG + Intergenic
1047461895 8:125073488-125073510 ACATATGGACTACAGTTATAGGG + Intronic
1047461898 8:125073555-125073577 ACATATGGACTACAGTTATAGGG + Intronic
1050811264 9:9750814-9750836 GCATATAGACTTCAGGAATTAGG - Intronic
1053344410 9:37367664-37367686 AAATTCAGACTTCAGTGATCTGG - Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055750769 9:79502386-79502408 ACAAAAGGACCTCAGTGATGGGG + Intergenic
1056031580 9:82559276-82559298 TCATTTAGACCTCAGTGATGTGG - Intergenic
1056479924 9:86991996-86992018 TCCTATAGAGTTCAGTGATAAGG + Intergenic
1058782237 9:108349960-108349982 AAATAGCGACATCAGTGATGGGG + Intergenic
1059756160 9:117295597-117295619 ATATATATATTTCAGTGATTTGG + Intronic
1187412183 X:19061144-19061166 CTGTATAGACTTCAGTGAGGTGG - Intronic
1188624772 X:32269859-32269881 ATCTACAGAATTCAGTGATGAGG - Intronic
1191926531 X:66317161-66317183 ACAAATAGACTTGCTTGATGAGG + Intergenic
1196706514 X:118722036-118722058 ACATATAGTTTTGAGTGCTGGGG + Intergenic