ID: 1159772709

View in Genome Browser
Species Human (GRCh38)
Location 18:72566169-72566191
Sequence GGTGTTGGCCAGGATATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159772703_1159772709 24 Left 1159772703 18:72566122-72566144 CCTCATGTCTGTTAGAACAGCTA 0: 1
1: 0
2: 11
3: 65
4: 334
Right 1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159772709 Original CRISPR GGTGTTGGCCAGGATATGGA GGG Intronic
901121422 1:6897269-6897291 GGTTTTGACCAACATATGGATGG + Intronic
901167806 1:7232190-7232212 GTGGTTGGCCAGCAGATGGAGGG + Intronic
901206813 1:7502225-7502247 GCCGTTGGCCAGGGTCTGGAGGG - Intronic
901752143 1:11416867-11416889 GGAGTTGGCCAGGAGATGAAGGG - Intergenic
901787831 1:11636380-11636402 GGTTCTGGACAGGGTATGGATGG + Intergenic
902623268 1:17662672-17662694 GGGGTAGGCCAGGGTATGGTAGG + Intronic
902795643 1:18799121-18799143 GGTGAAGGCCAGGACATGGCGGG - Intergenic
904059043 1:27693286-27693308 AGTTTTGGCCAAGTTATGGAAGG - Intergenic
905108523 1:35577843-35577865 GGTATTGGGCAGGAAATGGCAGG + Intronic
905675008 1:39818840-39818862 GGTGTTGCTCAGGAGAAGGAGGG + Intergenic
905760360 1:40551463-40551485 GGTGGTTGCCAGGAGCTGGAGGG - Intergenic
905887467 1:41499114-41499136 TGTGCTGGCCAGGATGTGCAGGG + Intergenic
907523749 1:55041391-55041413 GGTTGTGGCCAGGATAAGAAAGG + Intronic
908452512 1:64269761-64269783 GGTGTTGGCTGGGAGATGAAGGG + Intergenic
911180639 1:94857334-94857356 GGAGCTGCCCAGGTTATGGAAGG + Exonic
912566410 1:110590724-110590746 GGTGTTGGGCAGGCTCTGGAGGG + Intergenic
914973297 1:152331561-152331583 GGTGTTGGGCAGGTTAGGGAGGG + Intergenic
915988991 1:160494094-160494116 GGTATGTGCCAGGATATGAATGG - Intronic
916790271 1:168119482-168119504 GGTGGTTGCCAGGAGCTGGATGG + Intronic
916830333 1:168484398-168484420 GGTGTTGGCTAAAGTATGGATGG + Intergenic
918424534 1:184394961-184394983 GGTGTTGGGGAGGCCATGGAAGG - Intronic
918922991 1:190739293-190739315 TGTGTTGGTAAGAATATGGAGGG + Intergenic
918939555 1:190974209-190974231 GGTGTGGGCCAGTCTATTGATGG - Intergenic
920700774 1:208216831-208216853 GTTGATGGCCCGGATAGGGAAGG + Exonic
922565685 1:226600335-226600357 GGGCATGGCCAGGATATGGAGGG + Intronic
923507117 1:234613561-234613583 GGTGCTGTCCAGGAGATAGATGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063083202 10:2788259-2788281 AGTGTTGGCCAGTATTTGGTTGG - Intergenic
1064576937 10:16756163-16756185 GGTGATGGCCAGGGGCTGGAGGG + Intronic
1066302717 10:34111013-34111035 GGTGTAGGCAAAGAAATGGAAGG - Exonic
1067013187 10:42733511-42733533 GGTGATGGCCAGGGGCTGGAGGG - Intergenic
1067310649 10:45110589-45110611 GGTGATGGCCAGGGGCTGGAGGG + Intergenic
1070192897 10:74128692-74128714 GGTTTTGCCCAGGTTATGCATGG + Intronic
1070555838 10:77527277-77527299 GGGGGTGGCCTGGCTATGGATGG - Intronic
1070919916 10:80178139-80178161 GGTGCTGGACAGGCTAGGGAGGG - Intronic
1071419283 10:85474211-85474233 TGTGTTAGCCAGGATGAGGATGG + Intergenic
1073825639 10:107317456-107317478 GTTCTTTGCCAGGATATGGATGG + Intergenic
1074148891 10:110740797-110740819 GGTGTTGTCCAGCAGATGCATGG + Intronic
1075905933 10:126082261-126082283 GGCTGTGGCCAGGAAATGGACGG - Intronic
1075954515 10:126510621-126510643 GGTGCTGGTCAGGAAATGGATGG - Intronic
1076258764 10:129049431-129049453 AGTGTTTGCCAGGAACTGGATGG - Intergenic
1079036654 11:17025994-17026016 GGAGTTGGCTAGGATACAGAGGG - Intergenic
1079083775 11:17431175-17431197 AGTCTTGGCCAGGACAGGGAGGG - Intronic
1079319517 11:19440314-19440336 GGTGATGGTCAGGACAGGGAAGG + Intronic
1080705251 11:34685559-34685581 GGTGGTTTCCAGGATTTGGATGG - Intergenic
1082708093 11:56518385-56518407 GGTGAGGGCCAGGAAATGTAGGG - Intergenic
1083653874 11:64219825-64219847 GGGGTTGGTCTGCATATGGAGGG + Intronic
1084673056 11:70618946-70618968 GCAGATGGCCAGGAGATGGACGG + Intronic
1084783386 11:71426104-71426126 GCTCTTGGCCACCATATGGAGGG + Intergenic
1085746419 11:79118565-79118587 GGTGGTTGCCAGGGTCTGGAGGG - Intronic
1089048581 11:115526088-115526110 GGTGTGGACCAGGAGATAGAGGG - Intergenic
1090387306 11:126364554-126364576 GGTGTTGGGCTGGATGTGGGAGG + Intronic
1092078547 12:5693651-5693673 GGTCTGGGCCAGGGTATTGAGGG - Intronic
1092379750 12:7985949-7985971 GTTGATGGACTGGATATGGAAGG - Intergenic
1092979117 12:13776116-13776138 GTTCTTGGCAAGGACATGGATGG + Intronic
1095381579 12:41600891-41600913 AGTGTTGGCAAAGACATGGAGGG - Intergenic
1095830451 12:46580718-46580740 AGTGTTTGCTAGGGTATGGATGG - Intergenic
1096035731 12:48468381-48468403 GGGGTAGGCCTGGACATGGAAGG + Intergenic
1096469524 12:51867534-51867556 GGAGTTGACTGGGATATGGAGGG - Intergenic
1096611070 12:52802095-52802117 GGTTGAGGCCAGGATGTGGAGGG - Intergenic
1097932938 12:65210274-65210296 GATGTTGGCAAGGATTAGGAAGG + Intronic
1098955670 12:76687333-76687355 GGTTTGGGCCCGGATTTGGATGG + Intergenic
1098965226 12:76780922-76780944 TGTGTTAGCCAGGATGAGGATGG - Intronic
1099224378 12:79951775-79951797 AGTGGTTGCCAGGGTATGGAAGG - Intergenic
1099242421 12:80153722-80153744 TGTGGTTGCCAGGATTTGGAGGG - Intergenic
1100365275 12:93914849-93914871 GGTGGTTGCCAGGGTCTGGAGGG + Intergenic
1101517577 12:105451182-105451204 AGTGTTTTCCTGGATATGGAGGG + Intergenic
1101922587 12:108944850-108944872 AGTGTCGGCAAGGGTATGGAAGG - Intronic
1103482014 12:121256563-121256585 GGTGGTGGCCAGGGGATTGAGGG - Intronic
1103531393 12:121604681-121604703 GGTGGTGGCCAGGGGCTGGATGG + Intergenic
1105892510 13:24691676-24691698 GGGGTTGGCCAGGAAAGGGCTGG - Intronic
1106090494 13:26588695-26588717 GGTGTTGGCCAGGATGGGGAGGG - Intronic
1107179270 13:37439453-37439475 CATGTTGGCGAGGATGTGGATGG - Intergenic
1107819609 13:44274336-44274358 GGTGTGGGACAGCAGATGGAAGG - Intergenic
1108126312 13:47247855-47247877 GGTGGTTGCCAGGAGCTGGAGGG - Intergenic
1110200946 13:72850117-72850139 GGTTGTGGACTGGATATGGAAGG + Intronic
1110535812 13:76649595-76649617 AGTGTTGGTGAGGACATGGAGGG - Intergenic
1110551953 13:76820518-76820540 GGTGGTTGCCAGGGGATGGAAGG + Intergenic
1112120843 13:96409135-96409157 GGTATTTGGCTGGATATGGAAGG + Intronic
1112920618 13:104607351-104607373 GGTATTGCCGAGGATATTGAAGG - Intergenic
1113251229 13:108455341-108455363 GGAGATGGACAGGGTATGGAGGG - Intergenic
1117113778 14:52488318-52488340 GGTGCTGGGCAGGATGGGGAAGG + Intronic
1117695578 14:58358995-58359017 AGTGTTGGCAAGAATATGAAGGG - Intronic
1118390547 14:65291839-65291861 GGTCTTGGGCAGGAAAAGGAAGG - Intergenic
1121705758 14:95992338-95992360 GGTGTTGGCCAAGCTAAGGTTGG - Intergenic
1122215178 14:100198783-100198805 GGTGGTTGCCAGGGTTTGGATGG + Intergenic
1122282496 14:100631972-100631994 GGTGCTGGAGAGGATGTGGAGGG + Intergenic
1122463906 14:101917558-101917580 GGTGTGGGCCAGGGTATGGGCGG + Intronic
1123941016 15:25216714-25216736 GGAGTTGGGCAGGGCATGGATGG + Intergenic
1123989329 15:25671849-25671871 GGGGGTGGCCAGGAGCTGGAAGG - Intergenic
1124343754 15:28907540-28907562 GCTGTTGGCCAGGATGTGGAAGG + Intronic
1124964166 15:34420987-34421009 GATGTTGACCAGGATGTGGAAGG - Intronic
1124980779 15:34567215-34567237 GATGTTGACCAGGATGTGGAAGG - Intronic
1125513140 15:40303454-40303476 GGTGTTGGCCAAGATTTGAAGGG - Intronic
1127369206 15:58321390-58321412 GGTGGTTGCCAGGAGCTGGAGGG + Intronic
1127697339 15:61463274-61463296 GGTGCTGGAGAGGAGATGGATGG - Intergenic
1128356780 15:66933674-66933696 GGTGGTTGCCAGGAGCTGGAAGG - Intergenic
1130286489 15:82559516-82559538 GGTGTTGGCCAGGTTGTAGAGGG - Intronic
1130666505 15:85873956-85873978 GGTGTTGGGGAGGACCTGGAAGG + Intergenic
1131120962 15:89823316-89823338 GTTGTTGTCCAGGCTGTGGAAGG + Intergenic
1133538108 16:6721600-6721622 GGTGGTTGCCAGGAGCTGGAGGG - Intronic
1134110136 16:11510228-11510250 GGTGTTGGACAGCATCTAGAAGG - Intronic
1134179035 16:12032822-12032844 GGAGTTGGCAAGGATGTGGAAGG - Intronic
1134336398 16:13303569-13303591 GGTTTTTGCCAGGGTATGGAGGG + Intergenic
1135305781 16:21366560-21366582 GGAGTTGGCAAGGATGTGGAAGG - Intergenic
1135836165 16:25827344-25827366 GGTGTCGATCAGGGTATGGATGG - Intronic
1135861985 16:26064554-26064576 GGTGTAGGCCAGGACTGGGAAGG + Intronic
1136029161 16:27490138-27490160 GGTGGTGGCAGGGATACGGAGGG + Intronic
1136160121 16:28414561-28414583 GGTGTTGGTCAGGAGCCGGAAGG + Intergenic
1136202967 16:28700730-28700752 GGTGTTGGTCAGGAGCCGGAAGG - Intronic
1136302525 16:29345714-29345736 GGAGTTGGCAAGGATGTGGAAGG - Intergenic
1136568800 16:31084831-31084853 GGTGGTGGTCAGGATAGGGCAGG + Exonic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138732857 16:59215169-59215191 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1139317899 16:66089118-66089140 AGTGTACCCCAGGATATGGAAGG - Intergenic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1143517600 17:7427515-7427537 GGTGTGGGGCAGGGCATGGAGGG + Exonic
1143755133 17:9061453-9061475 GGTGGTGGCCAGGCTAAGGAAGG + Intronic
1144727555 17:17509478-17509500 GGGGTTGTCCAGGATGTTGAAGG + Exonic
1145177698 17:20715702-20715724 GGTAGAGGCCAGGAAATGGAAGG - Intergenic
1146621334 17:34400825-34400847 TGTGATGGCCAGCATGTGGAAGG - Intergenic
1146633337 17:34486149-34486171 GGTGGTTGCCAGGGTTTGGAGGG + Intergenic
1148563018 17:48616962-48616984 GGTGGTGGCCAGGCTTTAGAAGG + Intronic
1148818933 17:50349098-50349120 GGTGGGGGCCAGGATGTGGGAGG - Intronic
1149021879 17:51977236-51977258 GGTATTGGTCAGGATTTTGAGGG - Intronic
1150962838 17:69933951-69933973 GGTGGTTGCCAGGATCTGGAAGG - Intergenic
1151850316 17:76686036-76686058 GCTGCTGGACAGGATATGGAGGG - Intronic
1151896701 17:76985671-76985693 GGTGGTTGCCAGGAGCTGGAGGG + Intergenic
1153453962 18:5260178-5260200 GGTCTTGGACAAGATATAGAAGG - Intergenic
1155008428 18:21750758-21750780 GGTGTGGGGCAGGAGATGGCCGG - Intronic
1155985156 18:32222488-32222510 GGTGTTGTCCATGATATGGATGG + Intronic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1160225669 18:77009080-77009102 GGTGGTGGCCTGGGTCTGGAGGG + Intronic
1160387303 18:78504393-78504415 GGTGTCGGCCAGGAGGAGGATGG + Intergenic
1160786020 19:900613-900635 GATGGGGGGCAGGATATGGATGG - Intronic
1161102958 19:2430370-2430392 GGTGTGGGCCAGCATGGGGATGG - Exonic
1162403649 19:10461147-10461169 GGTGTTGGCCAGGCTGGGGGCGG + Intronic
1163099672 19:15087193-15087215 GATGATGGCCAGGATAATGAGGG - Exonic
1165721447 19:38082291-38082313 GGTGTGGGCCAGGATCTGCCCGG - Exonic
1165773474 19:38391151-38391173 GGTGTTGGCTAGCATCTGAAGGG + Intronic
1168405933 19:56110749-56110771 GGCCTTGACCAGGCTATGGATGG + Intronic
925491552 2:4400744-4400766 GAAGATGGGCAGGATATGGAGGG - Intergenic
926156071 2:10454646-10454668 GCTGTCAGCCAGGATTTGGATGG - Intergenic
926348285 2:11969805-11969827 GATGTTGGCAAGGATGTGGGAGG - Intergenic
926515028 2:13832817-13832839 GTTTTTGGCAGGGATATGGATGG + Intergenic
928107565 2:28481057-28481079 GGTGGTGGCCAGGGACTGGAGGG - Intronic
928610332 2:32986244-32986266 GATGTTGGTGAGGAGATGGATGG + Intronic
929229895 2:39548561-39548583 GGTGGTTGCCAGGATCTGCAGGG - Intergenic
929405142 2:41633133-41633155 AGTGATTGCCAGGGTATGGAGGG + Intergenic
930282978 2:49393505-49393527 GGTGTTGCCCAGAAAATGAAAGG - Intergenic
930678034 2:54225236-54225258 GGGGTGAGCCAGGATATGGCAGG + Intronic
930990784 2:57651117-57651139 GGTGTTGGCCAACCTATGAAAGG - Intergenic
934926418 2:98384777-98384799 GGTGTGGGCAAGGATGTGGGTGG + Intronic
935209459 2:100925953-100925975 CGTGGTTGCCAGGATCTGGAGGG - Intronic
936398656 2:112149476-112149498 GGTCTGAGCCAGCATATGGAGGG - Intronic
937466765 2:122139705-122139727 GGTCTTGCCCAGGGTCTGGACGG + Intergenic
939990043 2:148869302-148869324 GGTGGTTGCCAGGATACGGGAGG - Intergenic
940099895 2:150022863-150022885 GGAGTTGGCTATGTTATGGAAGG + Intergenic
942498318 2:176562555-176562577 GTTGCTGGCCAGCCTATGGATGG + Intergenic
944289833 2:197992715-197992737 GGTGGTTGCCAGGAGCTGGAGGG - Intronic
945112382 2:206372891-206372913 AGTGTTGGTGAGGATGTGGAGGG - Intergenic
946301019 2:218824103-218824125 GGAGTTGGTCATGAAATGGAAGG + Intronic
1169785569 20:9355934-9355956 GGTGCTGGAGAGGATGTGGAGGG - Intronic
1169848154 20:10018618-10018640 GGTGTTGGTGAGGATGTGGATGG - Intronic
1170852871 20:20020198-20020220 GGTGTGGGCCAGGATTTGAGGGG - Intronic
1172544905 20:35752682-35752704 GGTCTTTGCCAGGAGCTGGAGGG + Intergenic
1174110076 20:48192979-48193001 GGTGTTGTCCAGGAGGAGGAAGG - Intergenic
1175032373 20:55968725-55968747 CGTGTTGGTAAGGATGTGGAGGG - Intergenic
1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG + Intergenic
1176972716 21:15285489-15285511 GGTGGTGGCCAGGAGAAGGGAGG - Intergenic
1177174470 21:17689374-17689396 GCTGTTGGCCAGGGCATGGTGGG - Intergenic
1177903442 21:26946152-26946174 GGAGCTGGACAGGATATGAAAGG + Intronic
1179074581 21:38107935-38107957 GGTGTTGGCAAGAATACGGATGG + Intronic
1181898320 22:26130722-26130744 AGTGTTGGCGAGGATGTGGAGGG - Intergenic
1182241992 22:28923581-28923603 GGTGATGGTGAGTATATGGAGGG - Intronic
1182403741 22:30105821-30105843 GGTGATGGGGAGGATATTGATGG - Intronic
1183194757 22:36345763-36345785 GGTGTTGGCCAGGCTGAGGCTGG - Intronic
1184165007 22:42721779-42721801 GGTCGTGGCCAGGAGCTGGACGG - Intergenic
1184249032 22:43249805-43249827 GGGGGTGGCCAGGACATAGATGG + Intronic
1184608674 22:45588900-45588922 GGTGCTGGCCAGGTAATGGCGGG - Intronic
1184645362 22:45892136-45892158 GGTGTGGCCAAGGAGATGGAGGG - Intergenic
1185226261 22:49655223-49655245 GGTGCTGGCCAGGATCTTGGAGG - Intronic
949579258 3:5370810-5370832 GGTGGTTGCCAGGGGATGGAGGG - Intergenic
949928216 3:9058503-9058525 GGTGACAGCCAGGATGTGGAGGG + Intronic
950145217 3:10644720-10644742 GGTGGTTGCCAGGAGCTGGAGGG + Intronic
950353262 3:12378649-12378671 GGTGGTTGCCAGGAGCTGGAGGG + Intronic
951064241 3:18245909-18245931 GGTGGTTGCCAGGGGATGGAGGG - Intronic
953003159 3:38953102-38953124 GGAATTGGCAGGGATATGGATGG + Intergenic
954679179 3:52332411-52332433 GGTGATGCCCAGAATAGGGAAGG - Intronic
954867094 3:53738967-53738989 TTTCTTGGCCAGGCTATGGAAGG - Intronic
955393112 3:58535550-58535572 GGAGATGGCCAGGAGTTGGATGG + Intronic
955859406 3:63311573-63311595 GGTGTTGGCAGGGAGATGGATGG - Intronic
956166509 3:66401836-66401858 TGGGTTGGCCAGGAGATGGATGG - Intronic
958421353 3:93935175-93935197 GATGTTGGCAAGGATAAAGAAGG + Intronic
959013436 3:101106113-101106135 GGTGCTTGCCAGGGTCTGGAGGG + Intergenic
960912377 3:122662236-122662258 GCTGTGGTCCAGGAGATGGAGGG + Intergenic
961796848 3:129415300-129415322 GGTATTGGCCAGGATATCCATGG + Exonic
962049265 3:131795623-131795645 GGTTCTGGCCAGTCTATGGAGGG + Intronic
963283256 3:143407727-143407749 AGTGATGGTCAGGATAGGGAAGG + Intronic
963637471 3:147816889-147816911 GCATTTGGCCAGGATTTGGATGG + Intergenic
964435679 3:156650371-156650393 GCTGTTGACAAGGACATGGATGG + Intergenic
965353564 3:167646001-167646023 GGAGTTGGCCAGGAAATTGTTGG + Intronic
965780674 3:172282692-172282714 GGTGTTGGCCTTGAGGTGGATGG - Intronic
966103275 3:176302529-176302551 GGTGCTTGCCAGGAGCTGGAGGG - Intergenic
967188443 3:186965160-186965182 GATGTTGGCCAGTAAATGGTGGG - Intronic
969136401 4:5032804-5032826 GGTGCTTGCCAGGGTCTGGAGGG - Intergenic
969535150 4:7752079-7752101 TGTGGTGGTCAGGATATTGATGG - Intergenic
973647723 4:52967009-52967031 GGTGTTTGCCAGGTCCTGGAGGG - Intronic
973733109 4:53842821-53842843 GGTTCTGGCCAGTCTATGGAGGG - Intronic
975981632 4:80167470-80167492 AGTGTTGGCAAAGATATGGTAGG - Intergenic
982035371 4:151341046-151341068 GGTCATGGCCAGGCTATGAAAGG - Intergenic
982948629 4:161660775-161660797 GTTCTTTGCCAGGACATGGATGG - Intronic
983168593 4:164510090-164510112 GGTGTTGGTAAGGAGATGGAAGG + Intergenic
983508332 4:168580039-168580061 GGTGGTTGCCAGGGTTTGGATGG - Intronic
985272844 4:188210443-188210465 AGTGTTGCCCAGTATGTGGAGGG - Intergenic
992081526 5:73238078-73238100 AGTGTTGGCAGGGATATGAAGGG + Intergenic
994502253 5:100594298-100594320 GGTGTTGCTTAGGGTATGGAAGG - Intergenic
995731982 5:115255157-115255179 GGTCTTTGCCATGATTTGGAGGG + Intronic
997655263 5:135549664-135549686 GGCTTTGGCCAGGATCAGGAGGG - Intergenic
998479239 5:142448090-142448112 AGTGTTGGTGAGGATATGGGAGG - Intergenic
998508805 5:142694592-142694614 GGTGTTTGGCAGGATTTGGAAGG - Intronic
999093841 5:148960235-148960257 GGTGTTCACCAGGCTAAGGAAGG + Intronic
999271399 5:150298255-150298277 GTGGCTGGCCAGGATATGGCTGG + Exonic
1000381029 5:160629423-160629445 GGTGATGGCCTGCTTATGGAGGG + Intronic
1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG + Intergenic
1002685586 5:181006937-181006959 AGTGTTGGTGAGGATGTGGAGGG + Intergenic
1002961687 6:1921191-1921213 GTTATTGGCCAGGGTATGTATGG - Intronic
1004882264 6:20020718-20020740 GGTGGTTGCCAGGAGCTGGAGGG + Intergenic
1005400481 6:25427696-25427718 AGTGTTGGGGAGGATGTGGAGGG - Intronic
1006420312 6:33929651-33929673 AGTGTTGGTGAGGATGTGGAAGG + Intergenic
1007105085 6:39278277-39278299 GGTGGAGGTCAGGATCTGGATGG - Intergenic
1007175202 6:39891578-39891600 GGGGCTGGCCAGGATAGGGGTGG + Intronic
1008286749 6:49662305-49662327 GGTGGTGGCCAGGAGTTGGAGGG + Intergenic
1009751966 6:67886531-67886553 GGTGTTGAGCAGGATAGGGGTGG + Intergenic
1011703595 6:89979332-89979354 TGTGTTGGCCTGGATATATAGGG + Intronic
1012150111 6:95739301-95739323 AGTGTTGGCTAGAATTTGGAGGG + Intergenic
1012351276 6:98253895-98253917 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1016706912 6:147119463-147119485 GGTGTTTGCCAGGGGCTGGAGGG + Intergenic
1018336353 6:162794108-162794130 AGTGTTGGTGAGGATATGGAGGG - Intronic
1018503885 6:164443202-164443224 GATGTTGGTAAAGATATGGATGG + Intergenic
1019694349 7:2436808-2436830 GGTGTTTGCAGGGATGTGGAGGG + Intergenic
1021340985 7:19462339-19462361 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1022552303 7:31252402-31252424 GGTGTTAGCACGGATATGAATGG + Intergenic
1023168106 7:37363208-37363230 GGTGGTGGCCTGGACATGGAGGG - Intronic
1026366555 7:69654366-69654388 GGTCTGGGGCAGGATATGAAAGG - Intronic
1026638269 7:72103256-72103278 GGTGTCTTCCAGGATATCGATGG - Intronic
1028235687 7:88359046-88359068 GGTGTTAGCCAGGATAGGTTAGG + Intergenic
1028482717 7:91325299-91325321 AGAGTTGGCCAGGAGATGGATGG - Intergenic
1029970442 7:104783294-104783316 GGTTATGGTCAGGATAAGGATGG - Intronic
1031873210 7:127109882-127109904 GGTCTTTGGCAGGATAGGGAAGG - Intronic
1032954098 7:136950473-136950495 GTTATTTGCCAGGAAATGGATGG + Intronic
1034778348 7:153852984-153853006 GGGGTTGACCAGGAGATAGAGGG - Intergenic
1035125696 7:156607016-156607038 GGTGGTGGCCAGGTGATGGGGGG - Intergenic
1036959550 8:13228940-13228962 AGTGTTGGTAAGGATGTGGAGGG + Intronic
1037144339 8:15555007-15555029 GGTTTTGGCAAGGAGATTGAAGG + Intronic
1038380184 8:27085513-27085535 GGTGCTTGCCAGGAGCTGGAGGG + Intergenic
1038511157 8:28137017-28137039 GGTGTAGCCCAGGATAGGAATGG + Intronic
1039975923 8:42364770-42364792 GGTGTTTGCCAGGGCCTGGAAGG + Intronic
1043464656 8:80492869-80492891 GGTGTTGACCAGGATGGGGAGGG + Intronic
1049273629 8:141708877-141708899 GATGTTGGCCAGGTTCTGGGGGG + Intergenic
1049616915 8:143579551-143579573 GGGAGTGGCCAGGAGATGGAGGG + Intergenic
1053221026 9:36313334-36313356 GGTGTTTGCCAGGGGCTGGAGGG + Intergenic
1057392646 9:94652556-94652578 GGGGGTGGGCTGGATATGGAGGG - Intergenic
1057832524 9:98418088-98418110 GGTGTTGGCCAGGAGATAGCAGG + Intronic
1058936260 9:109772259-109772281 GGTGGTAGCCAGCACATGGAAGG - Intronic
1060545508 9:124456881-124456903 GGTGTTTGCTAGGAGATCGAGGG - Intronic
1061858929 9:133458030-133458052 GTTGGTGGCCAGGGCATGGATGG - Exonic
1062650311 9:137573000-137573022 GGTGTTGGCCAGGGTGTTGGAGG - Intronic
1185505912 X:632129-632151 GGAGGTGGCCGGGATCTGGATGG + Intronic
1186171611 X:6882950-6882972 GGTGTTGGGTAGGATAGGGCTGG + Intergenic
1186543652 X:10426376-10426398 GGTGGTGGCCAAGATCTGGTTGG - Intergenic
1186545298 X:10442834-10442856 GGTGATGGACTGGACATGGAGGG + Intergenic
1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG + Intronic
1188852711 X:35151119-35151141 GGTGCTGGCCAGGGTGGGGATGG - Intergenic
1189582306 X:42419769-42419791 GGTGGTGGGCAGGGGATGGATGG + Intergenic
1192980797 X:76338872-76338894 GTTCTTTGCCAGAATATGGATGG + Intergenic
1193995362 X:88360666-88360688 GATGTTTGCCAGAATTTGGAGGG + Intergenic
1195002155 X:100652199-100652221 GGTGGTGGCAAAGAAATGGAGGG + Intronic
1196194673 X:112827156-112827178 GGTTTTGAAAAGGATATGGAGGG - Intronic
1196457077 X:115898434-115898456 GGTGGTGGCCATGATCTGGGCGG - Intergenic
1196458012 X:115903463-115903485 GGTGGTGGCCATGATCTGGGCGG - Intergenic
1196463192 X:115949966-115949988 GGTGGTGGCCATGATATGGGTGG - Intergenic
1198840701 X:140854264-140854286 GGTGTTTTCCAGGAAATGAAAGG + Intergenic
1201062386 Y:10059063-10059085 GGTATTGCCCAGGCTATGGCAGG + Intergenic