ID: 1159779645

View in Genome Browser
Species Human (GRCh38)
Location 18:72646122-72646144
Sequence GCTCGAGGGACAAAGGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159779645_1159779648 -10 Left 1159779645 18:72646122-72646144 CCTCTTCCCTTTGTCCCTCGAGC No data
Right 1159779648 18:72646135-72646157 TCCCTCGAGCAGATAAATCAAGG No data
1159779645_1159779651 -3 Left 1159779645 18:72646122-72646144 CCTCTTCCCTTTGTCCCTCGAGC No data
Right 1159779651 18:72646142-72646164 AGCAGATAAATCAAGGTAGCTGG No data
1159779645_1159779652 10 Left 1159779645 18:72646122-72646144 CCTCTTCCCTTTGTCCCTCGAGC No data
Right 1159779652 18:72646155-72646177 AGGTAGCTGGACTTCTCACATGG No data
1159779645_1159779653 13 Left 1159779645 18:72646122-72646144 CCTCTTCCCTTTGTCCCTCGAGC No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159779645 Original CRISPR GCTCGAGGGACAAAGGGAAG AGG (reversed) Intergenic
No off target data available for this crispr