ID: 1159779647

View in Genome Browser
Species Human (GRCh38)
Location 18:72646129-72646151
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159779647_1159779652 3 Left 1159779647 18:72646129-72646151 CCTTTGTCCCTCGAGCAGATAAA No data
Right 1159779652 18:72646155-72646177 AGGTAGCTGGACTTCTCACATGG No data
1159779647_1159779651 -10 Left 1159779647 18:72646129-72646151 CCTTTGTCCCTCGAGCAGATAAA No data
Right 1159779651 18:72646142-72646164 AGCAGATAAATCAAGGTAGCTGG No data
1159779647_1159779653 6 Left 1159779647 18:72646129-72646151 CCTTTGTCCCTCGAGCAGATAAA No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159779647 Original CRISPR TTTATCTGCTCGAGGGACAA AGG (reversed) Intergenic
No off target data available for this crispr