ID: 1159779649

View in Genome Browser
Species Human (GRCh38)
Location 18:72646136-72646158
Sequence ACCTTGATTTATCTGCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159779649_1159779652 -4 Left 1159779649 18:72646136-72646158 CCCTCGAGCAGATAAATCAAGGT No data
Right 1159779652 18:72646155-72646177 AGGTAGCTGGACTTCTCACATGG No data
1159779649_1159779653 -1 Left 1159779649 18:72646136-72646158 CCCTCGAGCAGATAAATCAAGGT No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data
1159779649_1159779654 30 Left 1159779649 18:72646136-72646158 CCCTCGAGCAGATAAATCAAGGT No data
Right 1159779654 18:72646189-72646211 TTAGAGACCAAATGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159779649 Original CRISPR ACCTTGATTTATCTGCTCGA GGG (reversed) Intergenic
No off target data available for this crispr