ID: 1159779653

View in Genome Browser
Species Human (GRCh38)
Location 18:72646158-72646180
Sequence TAGCTGGACTTCTCACATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159779645_1159779653 13 Left 1159779645 18:72646122-72646144 CCTCTTCCCTTTGTCCCTCGAGC No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data
1159779649_1159779653 -1 Left 1159779649 18:72646136-72646158 CCCTCGAGCAGATAAATCAAGGT No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data
1159779647_1159779653 6 Left 1159779647 18:72646129-72646151 CCTTTGTCCCTCGAGCAGATAAA No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data
1159779646_1159779653 7 Left 1159779646 18:72646128-72646150 CCCTTTGTCCCTCGAGCAGATAA No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data
1159779650_1159779653 -2 Left 1159779650 18:72646137-72646159 CCTCGAGCAGATAAATCAAGGTA No data
Right 1159779653 18:72646158-72646180 TAGCTGGACTTCTCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159779653 Original CRISPR TAGCTGGACTTCTCACATGG TGG Intergenic
No off target data available for this crispr