ID: 1159779654

View in Genome Browser
Species Human (GRCh38)
Location 18:72646189-72646211
Sequence TTAGAGACCAAATGAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159779650_1159779654 29 Left 1159779650 18:72646137-72646159 CCTCGAGCAGATAAATCAAGGTA No data
Right 1159779654 18:72646189-72646211 TTAGAGACCAAATGAGAGACAGG No data
1159779649_1159779654 30 Left 1159779649 18:72646136-72646158 CCCTCGAGCAGATAAATCAAGGT No data
Right 1159779654 18:72646189-72646211 TTAGAGACCAAATGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159779654 Original CRISPR TTAGAGACCAAATGAGAGAC AGG Intergenic
No off target data available for this crispr