ID: 1159779655

View in Genome Browser
Species Human (GRCh38)
Location 18:72646190-72646212
Sequence TAGAGACCAAATGAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159779650_1159779655 30 Left 1159779650 18:72646137-72646159 CCTCGAGCAGATAAATCAAGGTA No data
Right 1159779655 18:72646190-72646212 TAGAGACCAAATGAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159779655 Original CRISPR TAGAGACCAAATGAGAGACA GGG Intergenic
No off target data available for this crispr