ID: 1159780932

View in Genome Browser
Species Human (GRCh38)
Location 18:72659603-72659625
Sequence TATCCATCCTTGAGTGCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159780932_1159780937 4 Left 1159780932 18:72659603-72659625 CCCAAAGCACTCAAGGATGGATA No data
Right 1159780937 18:72659630-72659652 AGGAGGTAACTGAGTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159780932 Original CRISPR TATCCATCCTTGAGTGCTTT GGG (reversed) Intergenic
No off target data available for this crispr