ID: 1159782347

View in Genome Browser
Species Human (GRCh38)
Location 18:72674878-72674900
Sequence CTGCCCCAGCCTCCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159782337_1159782347 2 Left 1159782337 18:72674853-72674875 CCTCCAGCCGCAGCCACCCCCAG No data
Right 1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG No data
1159782339_1159782347 -1 Left 1159782339 18:72674856-72674878 CCAGCCGCAGCCACCCCCAGGTC No data
Right 1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG No data
1159782340_1159782347 -5 Left 1159782340 18:72674860-72674882 CCGCAGCCACCCCCAGGTCTGCC No data
Right 1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG No data
1159782336_1159782347 15 Left 1159782336 18:72674840-72674862 CCTTGGCGGGGAGCCTCCAGCCG No data
Right 1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159782347 Original CRISPR CTGCCCCAGCCTCCCAGGAG AGG Intergenic
No off target data available for this crispr