ID: 1159784689

View in Genome Browser
Species Human (GRCh38)
Location 18:72698814-72698836
Sequence CTGTGACTCTGGAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159784685_1159784689 0 Left 1159784685 18:72698791-72698813 CCTTCTTGCTTTAACTCTTGCTC No data
Right 1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159784689 Original CRISPR CTGTGACTCTGGAGGCAAGA AGG Intergenic
No off target data available for this crispr