ID: 1159786025

View in Genome Browser
Species Human (GRCh38)
Location 18:72715355-72715377
Sequence CTGAAACAAATTTAGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159786025_1159786028 26 Left 1159786025 18:72715355-72715377 CCTTCTATCTAAATTTGTTTCAG No data
Right 1159786028 18:72715404-72715426 GAAATTTTCATGTCTATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159786025 Original CRISPR CTGAAACAAATTTAGATAGA AGG (reversed) Intergenic
No off target data available for this crispr