ID: 1159789090

View in Genome Browser
Species Human (GRCh38)
Location 18:72754162-72754184
Sequence TTTACTTTCTTAGTTGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 755}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159789090_1159789091 15 Left 1159789090 18:72754162-72754184 CCTAAAGCAACTAAGAAAGTAAA 0: 1
1: 0
2: 3
3: 72
4: 755
Right 1159789091 18:72754200-72754222 CTCTAAAATAATTAAAATGTTGG 0: 1
1: 0
2: 5
3: 79
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159789090 Original CRISPR TTTACTTTCTTAGTTGCTTT AGG (reversed) Intronic
901887911 1:12236713-12236735 TTTACTGTTCTAGATGCTTTGGG + Intronic
902332480 1:15737239-15737261 TTTAATTTTTTATTTGTTTTGGG - Intronic
902829193 1:18998956-18998978 TTCAGTTTTTTAGTTGCTTAGGG - Intergenic
903348405 1:22702665-22702687 TTTACTTTCTGTGTGGCTTTGGG - Intergenic
903385866 1:22925995-22926017 TTTACTTTCTTGGGTGCTTTAGG - Intergenic
903727500 1:25461442-25461464 TTTACTGTCTGAGTGGCCTTGGG + Intronic
904968051 1:34394833-34394855 TTTTCTTTCTTAGTTACTTAGGG - Intergenic
905555253 1:38877495-38877517 TTTTCTTTCTTTCTTTCTTTTGG + Intronic
905781803 1:40717726-40717748 TTTATTTTTTGAGTTGCTTTGGG + Intronic
906501628 1:46345389-46345411 TTAAGATTCTTACTTGCTTTAGG + Intronic
906920414 1:50058554-50058576 TTTACTTTTTTTTTTTCTTTAGG - Intronic
907306532 1:53516286-53516308 TTTACCTTCTCAGTTGGTTGGGG + Intronic
907505360 1:54914287-54914309 GGAACCTTCTTAGTTGCTTTAGG + Intergenic
909282507 1:73772507-73772529 TTTTATTTGTTTGTTGCTTTAGG - Intergenic
909431865 1:75597373-75597395 TTGAATTTATAAGTTGCTTTGGG - Intronic
909880696 1:80873752-80873774 TCTACTTTCTTAATATCTTTGGG + Intergenic
909950084 1:81708794-81708816 TTTCCTTTATTTTTTGCTTTGGG + Intronic
909961298 1:81847005-81847027 TTTTCTTGTTTGGTTGCTTTTGG + Intronic
910403873 1:86865038-86865060 TCTAATTTCTTATTTCCTTTTGG - Intronic
910546220 1:88422478-88422500 TTTCCTTTCTTCCTTGCTTAAGG - Intergenic
910846217 1:91606783-91606805 TTTACTTTATCAGTTGATTAGGG + Intergenic
911580269 1:99625931-99625953 ATTACTTTTTTAATTGCTCTGGG - Intergenic
912139759 1:106709393-106709415 TTTTTTTTCCTAGTTCCTTTAGG + Intergenic
912990020 1:114476206-114476228 TTTTTTTTCTTATTTGTTTTTGG - Intronic
913081650 1:115394035-115394057 ATTAGTTTCTTTTTTGCTTTGGG - Intergenic
913510916 1:119561288-119561310 TTTAATTTCTCACTTTCTTTAGG + Intergenic
913515137 1:119598694-119598716 TTTAATTTCTCACTTTCTTTAGG + Intergenic
913968941 1:143399336-143399358 TTTATTTATTTATTTGCTTTTGG + Intergenic
914063319 1:144224935-144224957 TTTATTTATTTATTTGCTTTTGG + Intergenic
914115831 1:144741419-144741441 TTTATTTATTTATTTGCTTTTGG - Intergenic
914973829 1:152338644-152338666 TTTACTTTGTCATTTGTTTTAGG - Intergenic
915819600 1:159007834-159007856 ACTACTATCTTAGTTGATTTGGG - Intronic
915844172 1:159246470-159246492 TTTAATTTGTTAGTTTATTTGGG + Intergenic
915923461 1:159996574-159996596 TTTATTTTCCCAGTTGCTTTGGG - Intergenic
916092839 1:161321907-161321929 TTTACCTTCTTAAATGCTTTTGG + Intronic
916888195 1:169090936-169090958 TTTAGTTTATTAGGGGCTTTTGG - Intergenic
917564122 1:176194205-176194227 TTTTCTTCCTTTCTTGCTTTTGG - Intronic
917612701 1:176704556-176704578 TTCAGTTTTTTAGTTGCATTTGG - Intronic
918060762 1:181059429-181059451 TTTTCTTTCATAGTTTCTATGGG + Exonic
918162144 1:181911265-181911287 ATTTCCTTCCTAGTTGCTTTTGG + Intergenic
918285011 1:183044260-183044282 TTTACTGTCCTAGTTTCTTTTGG + Intronic
918492812 1:185100178-185100200 TTTTCTTTCTTTTTTGTTTTAGG + Exonic
919193206 1:194249856-194249878 TTTATTTTGCTAATTGCTTTGGG - Intergenic
919423032 1:197394940-197394962 TTTATTTATTTAGTTGCCTTAGG - Intronic
919615195 1:199798184-199798206 TTTATTTTCTTAGATATTTTTGG + Intergenic
919984404 1:202662738-202662760 TTTACTATCTGAGTAGCCTTGGG + Intronic
920237657 1:204519236-204519258 TTTACTTTTTAAAATGCTTTTGG + Intronic
920672133 1:208012250-208012272 TTTAATTTTTTAGTTTATTTGGG + Intergenic
921173413 1:212569218-212569240 ATTTGTTTCTTTGTTGCTTTTGG + Intronic
921543623 1:216448858-216448880 TTTATTTTCTGAAGTGCTTTAGG - Intergenic
921558824 1:216631999-216632021 TTTTCTTTCTTAGAAGCCTTCGG - Intronic
921764183 1:218951169-218951191 TGGAATTTCTTTGTTGCTTTGGG + Intergenic
923303502 1:232665671-232665693 TCTTCTTTCTTACTTACTTTTGG - Intergenic
923418986 1:233793835-233793857 TTGAATTTATTAATTGCTTTGGG - Intergenic
923481319 1:234386996-234387018 GTTACTTTTATAATTGCTTTGGG - Intergenic
923796418 1:237160771-237160793 CTTAGTTTCTTAGTTCTTTTGGG - Intronic
924035963 1:239937843-239937865 GTTCCTTTCTTATTTTCTTTTGG - Intergenic
924072318 1:240294130-240294152 TGTGCTTTATTACTTGCTTTAGG - Intronic
924433399 1:244016966-244016988 TATACTGTCTTAGTTTCTTTGGG - Intergenic
1063333882 10:5190431-5190453 TTGACTCTATTAATTGCTTTGGG - Intergenic
1063471752 10:6293342-6293364 TTTTCTTTCTTTCTTTCTTTCGG + Intergenic
1063672182 10:8108019-8108041 TTTCCTTTGGTATTTGCTTTGGG + Intergenic
1063901345 10:10735484-10735506 TTTAGTTCCAAAGTTGCTTTTGG - Intergenic
1064168699 10:13009457-13009479 TTTATTTTCTAAGTTGTTTTTGG - Intronic
1064497171 10:15923495-15923517 TTTTCTTGCTTCGTTGCTCTGGG + Intergenic
1064634781 10:17353888-17353910 TTTTGTTTCTTAGTTTCTTTTGG - Intronic
1065072833 10:22044722-22044744 TCCACCTTCTTTGTTGCTTTGGG - Intergenic
1065109124 10:22422972-22422994 TATACTTGCTCAGGTGCTTTAGG - Intronic
1065491672 10:26288525-26288547 TTTACATTCTTGACTGCTTTGGG - Intronic
1065581031 10:27172184-27172206 TTTACTTTTTTTCTTCCTTTGGG + Intronic
1066705555 10:38174277-38174299 TTTACTTTCTGATATGGTTTGGG + Intergenic
1066984890 10:42456057-42456079 TTTACTTTCTGATATGGTTTGGG - Intergenic
1067154607 10:43767355-43767377 TTTGTTTTCTTATTTGGTTTTGG - Intergenic
1067163149 10:43843859-43843881 TTCAAATTCTGAGTTGCTTTTGG + Intergenic
1067453824 10:46398908-46398930 TTTTTTTTAATAGTTGCTTTGGG + Intergenic
1067633377 10:47985722-47985744 TTTTTTTTAATAGTTGCTTTGGG - Intergenic
1067991665 10:51220326-51220348 TATAATCTCTTAGTTTCTTTAGG - Intronic
1068349780 10:55828088-55828110 TTAACTCTCATAGTTGCTGTGGG + Intergenic
1068377603 10:56204233-56204255 TTTACTTTCTGTTTTTCTTTTGG - Intergenic
1068504826 10:57887191-57887213 TTTACATTCTTCGTAGATTTTGG - Intergenic
1069803602 10:71101862-71101884 TATTTTTTCTTAGTTGCTCTAGG + Intergenic
1069803687 10:71103036-71103058 TATTTTTTCTTAGTTGCTCTAGG - Intergenic
1070002315 10:72388685-72388707 TTTTTTTTCCCAGTTGCTTTTGG - Intronic
1070078440 10:73161560-73161582 TTTTCTTTGTTAGGAGCTTTTGG - Intronic
1070139529 10:73728518-73728540 TTTTCTTTCTTTGTTTCTTCTGG + Intergenic
1070350467 10:75587251-75587273 TTTACATTCATAGTAGCTTTTGG + Intronic
1070886746 10:79906619-79906641 TTTTCTTTCTTTGTTTCTTCTGG - Intergenic
1071221907 10:83477268-83477290 TTTACTTTAACAGTTGGTTTGGG - Intergenic
1071395172 10:85216323-85216345 TTTCCTTTCCTAGTTACGTTGGG - Intergenic
1071584083 10:86802111-86802133 TTTACTCTCTCAGTAGCATTTGG + Intronic
1071696721 10:87882973-87882995 TTTACTTTATAAGTTGTTTAAGG + Intronic
1072080448 10:92024743-92024765 TTTTCTTCCTAAGTTGCTGTTGG + Exonic
1072548768 10:96461025-96461047 TCTACTCTCTTAGTTGGTTTGGG - Intronic
1072586051 10:96783368-96783390 TTTATTTTAAAAGTTGCTTTAGG + Intergenic
1072908626 10:99479704-99479726 TTGAATTTGTAAGTTGCTTTGGG - Intergenic
1073168614 10:101481644-101481666 TTTAATTTCTTCCATGCTTTTGG + Intronic
1073926270 10:108519854-108519876 TTTCTTATCTTAGTTGCTGTAGG - Intergenic
1073930720 10:108571471-108571493 TTTTCTTTCCTAGGTCCTTTGGG - Intergenic
1073952914 10:108831374-108831396 TTTATTTTTCTAGTTTCTTTAGG - Intergenic
1074254801 10:111791131-111791153 TTTTTTTTCTTGCTTGCTTTGGG + Intergenic
1074712858 10:116192127-116192149 TTTAATTTCTTAGTGGTTTGGGG + Intronic
1075130718 10:119736635-119736657 GTTCCTTTTTGAGTTGCTTTGGG + Intronic
1075809334 10:125213252-125213274 TTTCCTATCTAAGTTGCTTCAGG - Intergenic
1076005500 10:126945295-126945317 TTCACTTTCTTGGTGGCTGTTGG + Intronic
1076227047 10:128786444-128786466 TTTTCTTACTTATTTGCTTTAGG + Intergenic
1076665471 10:132087564-132087586 TTTTCTTTCTTTGTTGGATTGGG + Intergenic
1077814195 11:5669382-5669404 TTTACATTCTTAATGGTTTTAGG + Intronic
1078388022 11:10910035-10910057 TTTGCTTTCTTAAGTTCTTTGGG - Intergenic
1078701382 11:13687526-13687548 TTTGCTTTTCTAGTTGCTTCTGG + Intronic
1078784361 11:14473641-14473663 GTTACTATCATAGTTGTTTTGGG - Intronic
1078827729 11:14946641-14946663 TTTAAATTTTTAGTTGTTTTTGG - Intronic
1079306149 11:19324743-19324765 TTGAATTTGTAAGTTGCTTTCGG - Intergenic
1079775435 11:24520004-24520026 TTTATTTCATTAGTTGCCTTGGG + Intronic
1079778528 11:24565771-24565793 TTTACTTTTTTGTTTACTTTTGG - Intronic
1080132322 11:28811432-28811454 TCTACTCTCTTAGCTGCATTTGG + Intergenic
1080921697 11:36715468-36715490 TTTACTTTCTTGGTTGTTTTGGG + Intergenic
1081653944 11:44844780-44844802 TTTGCTTTCTTACTTTCTTATGG + Intronic
1085006441 11:73095489-73095511 CTTACTCTCTTTGTTTCTTTTGG - Intronic
1085794190 11:79521883-79521905 TTTGCTTTCTTTCTTTCTTTGGG - Intergenic
1085931171 11:81085691-81085713 TTTTCTTTGTTAGGTGTTTTGGG + Intergenic
1086361633 11:86066769-86066791 ATTCTTTTGTTAGTTGCTTTTGG - Intronic
1086523295 11:87696981-87697003 TTTATTTTGTTAGGTGCTTTAGG + Intergenic
1086664075 11:89457675-89457697 TTTATTTTCTTTGATGCCTTTGG - Intronic
1086772736 11:90789872-90789894 ACTACATTCTTTGTTGCTTTTGG + Intergenic
1086774124 11:90808615-90808637 TTTTCTTTTTTTGTTGTTTTTGG + Intergenic
1087031078 11:93704904-93704926 TTTACTTCCATAGTTGCAGTGGG + Intronic
1087191887 11:95263531-95263553 TATACTTTCTTAGTTTGTCTGGG + Intergenic
1087513939 11:99132828-99132850 TTTAATCTATTAATTGCTTTGGG - Intronic
1087591885 11:100199683-100199705 TGGACATTCTTATTTGCTTTCGG - Intronic
1087630410 11:100644097-100644119 TTTAATTGCATATTTGCTTTTGG - Intergenic
1087879454 11:103398204-103398226 TTTTATTACTTAGTTGATTTAGG + Intronic
1087962856 11:104373737-104373759 TTTACTGTCTTGGTTGGGTTGGG + Intergenic
1088115880 11:106312438-106312460 TTTACTGTTTTAGTTTATTTGGG - Intergenic
1088210453 11:107448923-107448945 TCTACTGTCTTAGTTCATTTGGG - Intronic
1088406260 11:109482208-109482230 TTTCCTTTATTATTTGCTTAAGG - Intergenic
1088733551 11:112706147-112706169 CTTACTTTGTTAGTTCCTGTGGG - Intergenic
1089153214 11:116380619-116380641 TTTACTATGTGAGTTTCTTTGGG + Intergenic
1089371294 11:117960704-117960726 TTTCCTCTCTCATTTGCTTTAGG - Intergenic
1089994594 11:122893785-122893807 ATTACTTTATTAGTTGGATTGGG - Intronic
1090612195 11:128481270-128481292 TTTACTGTGTGAGTTGCTTAAGG + Intronic
1090781885 11:130014354-130014376 TTTTTTTTCTTAGTTGTTTTAGG - Intergenic
1090961835 11:131563998-131564020 TTTACTTTCTTGGTGGCCTCAGG - Intronic
1092310962 12:7352174-7352196 TTTAGTTTTATAGTTCCTTTAGG - Intronic
1092748751 12:11698504-11698526 TTTAGTTTCTTACTAGCTGTTGG + Intronic
1093245046 12:16726018-16726040 TTAACTTTCTAATCTGCTTTTGG - Intergenic
1093311563 12:17592858-17592880 TTTTTTTTTTTAATTGCTTTGGG + Intergenic
1094117453 12:26932535-26932557 TTTACTCTCTTATGTGCTTTTGG - Intronic
1095523566 12:43097358-43097380 ATTATTTTCTTAATTGATTTAGG + Intergenic
1095616770 12:44199590-44199612 TTGACTTTCTTAGTTGCACAAGG + Intronic
1096014980 12:48262702-48262724 TTTTTTTTCTTAGTTGGGTTAGG + Intergenic
1096048718 12:48587008-48587030 TTTATTTTGTTAGGTGTTTTGGG - Intergenic
1096300485 12:50423213-50423235 TTTATTTTCTTAGTCTTTTTAGG + Intronic
1096481607 12:51945163-51945185 TTTCCTTTCTCAATTCCTTTTGG + Intergenic
1098833897 12:75397380-75397402 TTTATTATTTTAGTTTCTTTGGG + Intronic
1098938357 12:76506169-76506191 TTCATTTTCTCAATTGCTTTGGG - Intronic
1099449625 12:82793206-82793228 TTTCCTTTTTTAGTACCTTTTGG + Intronic
1099472641 12:83070253-83070275 TTTAATTTTTTGATTGCTTTTGG + Intronic
1099896286 12:88651497-88651519 ATCACTTTCTTCTTTGCTTTTGG - Intergenic
1100407214 12:94282115-94282137 TTTACTTTGTTTGTTTGTTTAGG - Intronic
1100480339 12:94971919-94971941 TTTTCTTTCTTTCTTTCTTTTGG + Intronic
1100523911 12:95402483-95402505 TTTTTTTTCCAAGTTGCTTTTGG + Intergenic
1100928388 12:99577031-99577053 TTTATTTTTTTAGTTCCTCTAGG - Intronic
1102181905 12:110919177-110919199 TTTGCTTTCTTAGGTGCCTGGGG + Exonic
1102479457 12:113211390-113211412 TTTTCGTTCTTAGTCACTTTGGG - Intronic
1103625072 12:122212546-122212568 TATTTTTTCTTAGTAGCTTTTGG + Intronic
1103842815 12:123879077-123879099 ATTACTTTCTTAGCTTCTGTTGG + Intronic
1104137222 12:125952164-125952186 TCTGCTTTCTTAGTTGCAGTGGG - Intergenic
1104558146 12:129820751-129820773 TTTATTTTATTATTTGTTTTTGG + Intronic
1105556611 13:21452783-21452805 GTTACTTTATTGATTGCTTTAGG - Intronic
1105869697 13:24493724-24493746 TTTATTATTGTAGTTGCTTTTGG - Exonic
1106030922 13:26001894-26001916 TTTATTTTGTTACTTGCATTTGG + Intronic
1106994283 13:35463049-35463071 TTTATTTTCTTACTTTCCTTAGG - Intronic
1107186759 13:37531369-37531391 TTTCCTTGCTTAGTTGCCCTTGG + Intergenic
1107197925 13:37676253-37676275 TTTTTTTTCTTGGCTGCTTTCGG - Intronic
1107262314 13:38508452-38508474 ATTACTTTCTCTCTTGCTTTAGG + Intergenic
1107292392 13:38870088-38870110 ATTTTTTTCTTAGTTGCTTTAGG + Intronic
1107657439 13:42605993-42606015 TTTCCTGTCTCAGTTGCCTTTGG + Intronic
1108240114 13:48455595-48455617 TCTACTTTCTGATTTTCTTTTGG - Intronic
1108423016 13:50270033-50270055 TTTACTGTCTTAGTTCTTTTGGG + Intronic
1108566856 13:51708180-51708202 GTTATTTTAATAGTTGCTTTGGG - Intronic
1109023553 13:57130928-57130950 TTTACTTTCTTAGCTGTGCTGGG + Intergenic
1109551614 13:63910004-63910026 TTTTTTGTCTTAGCTGCTTTGGG + Intergenic
1109568785 13:64157829-64157851 TTTACTTTCCTGGATTCTTTAGG + Intergenic
1109793779 13:67283552-67283574 TTTACTTTCATAGTATATTTTGG - Intergenic
1109843829 13:67957699-67957721 TTTACTTTCTTCTTTTCTTGGGG - Intergenic
1110336806 13:74342269-74342291 TTTGCTTTCCTAGTTCCTTGAGG + Intergenic
1110430816 13:75421104-75421126 TTTGCTTTCCTAGTTTCTTTTGG + Intronic
1110476145 13:75916290-75916312 TCCACTTTCTAAGTTGTTTTGGG + Intergenic
1110573695 13:77032979-77033001 TTTCCTTTCTTTTTTGGTTTGGG - Intergenic
1110587094 13:77205598-77205620 TTTTGTTTCTTTGTTGTTTTAGG - Exonic
1110647163 13:77901045-77901067 TGTATTTTCTTACCTGCTTTAGG + Exonic
1110697521 13:78509032-78509054 TTTTCTTTCTTTGTCTCTTTTGG + Intergenic
1110803788 13:79731710-79731732 TTTTCTTGCCTGGTTGCTTTGGG + Intergenic
1111071115 13:83169577-83169599 TTTACATTATTACATGCTTTTGG + Intergenic
1111089733 13:83427873-83427895 TTTAATCTATAAGTTGCTTTGGG + Intergenic
1111461863 13:88555421-88555443 TATTGTTTCTTAGTTGCTGTGGG + Intergenic
1111478348 13:88784733-88784755 TTGAATTTATTAATTGCTTTGGG + Intergenic
1111671475 13:91335674-91335696 TTATCTTGCTTAATTGCTTTAGG + Intergenic
1111694590 13:91607315-91607337 TTTACGTTCTTAGAAGATTTGGG + Intronic
1111875472 13:93888633-93888655 TTTCTTCTCTTAGATGCTTTTGG + Intronic
1113090514 13:106613071-106613093 TTTACTATCTCAGTTTCTGTAGG - Intergenic
1113317296 13:109195279-109195301 TTTTGTTTCTTTGTTGCTTAAGG - Intronic
1113511718 13:110861125-110861147 TTTATTTTTATAGTTTCTTTGGG + Intergenic
1114350408 14:21844258-21844280 TCTACTATCTTAGTTGCTTTTGG + Intergenic
1114841066 14:26262267-26262289 TTTACTTTCTTACTTTCTACTGG - Intergenic
1114885785 14:26849293-26849315 TTTGCTTTCTTAACTTCTTTTGG - Intergenic
1115394156 14:32888698-32888720 CTTCCTTTCTTAGTTTCTTAAGG - Intergenic
1115678175 14:35704870-35704892 TTTACTTTCTGACTTGCATTGGG - Intronic
1116104339 14:40481153-40481175 TTTACTTACTTTGATGCTTTTGG + Intergenic
1116187595 14:41617550-41617572 TTTAGTTTCTCATGTGCTTTTGG + Intronic
1116202209 14:41812442-41812464 TTTAATTTCTTAGTACCTTCTGG + Intronic
1116548084 14:46197202-46197224 TTTATTATCTTAGTTTCTATGGG + Intergenic
1116637685 14:47418022-47418044 TTTTCTATCTTAGTTTGTTTGGG + Intronic
1117669028 14:58087137-58087159 TTTAATTTCTTCTTCGCTTTTGG + Intronic
1117691103 14:58307258-58307280 TTTACTTGATTTGTTGCTTTGGG + Intronic
1118176719 14:63447989-63448011 GTTACTATTTTAATTGCTTTGGG - Intronic
1118547641 14:66910374-66910396 TTTTCTTTTTTAATTTCTTTTGG - Intronic
1119378303 14:74212658-74212680 TTCAGTTTCTTAGTTGCGCTAGG + Intergenic
1120488364 14:85144868-85144890 TTTACTTTCTAAATACCTTTAGG + Intergenic
1120561196 14:85995082-85995104 TTTACCTTATTAATGGCTTTAGG + Intergenic
1120605626 14:86573500-86573522 TCTACTTTCCTCTTTGCTTTTGG - Intergenic
1121649564 14:95547802-95547824 TTTCCTTTCTTCATTCCTTTTGG + Intergenic
1122039616 14:98975301-98975323 GTTATTTTAATAGTTGCTTTAGG - Intergenic
1122567031 14:102666570-102666592 TTTAGTTGCCTTGTTGCTTTAGG + Intronic
1123455866 15:20424832-20424854 TTTTCTTTTCTAGTTCCTTTAGG + Intergenic
1123635704 15:22306005-22306027 TTTTCTTTTCTAGTTCCTTTAGG - Intergenic
1124480922 15:30079173-30079195 TTTTTTTTCTTAGTTTATTTTGG + Intergenic
1125935234 15:43629384-43629406 TTAACTTACTTAATTTCTTTAGG + Intronic
1125947991 15:43725696-43725718 TTAACTTACTTAATTTCTTTAGG + Intergenic
1126031307 15:44501163-44501185 TTTTCTTTGTTTTTTGCTTTTGG + Intronic
1126518545 15:49561929-49561951 TTTATTTTTCTAGTTCCTTTAGG - Intronic
1126538945 15:49801080-49801102 TTTACTTTTTTTTTTCCTTTTGG - Intergenic
1127303147 15:57677241-57677263 CTGACTTTCTCAGTTGTTTTGGG - Intronic
1127624187 15:60764101-60764123 TTGCCTTTCTTAATTTCTTTTGG - Intronic
1127720766 15:61696985-61697007 CTAACTCTCTTAGTTGCTCTTGG - Intergenic
1129639488 15:77360349-77360371 TTTATTTTTTTGGTTGCTTTTGG - Intronic
1131089090 15:89606298-89606320 TTTCCATTCTTAGATGTTTTTGG + Intronic
1131295283 15:91142702-91142724 TTTACTGTCTGAGTGGCCTTGGG - Intronic
1133592916 16:7263517-7263539 TGTAGTTCCTTAGGTGCTTTGGG + Intronic
1133834762 16:9358013-9358035 TTTACTGTTTTAGTTTGTTTTGG + Intergenic
1133870627 16:9682344-9682366 TTTATTTCTTTAGTGGCTTTAGG + Intergenic
1134436898 16:14267960-14267982 TATATTTTTTTAGTAGCTTTGGG + Intergenic
1134484997 16:14650948-14650970 TTAAATTTCTTTGTTGCTTCCGG + Intronic
1134843703 16:17422506-17422528 TTTACTTTATTATTTTTTTTTGG + Intronic
1135485396 16:22860540-22860562 TTTACTATATCACTTGCTTTTGG + Intronic
1135902116 16:26470717-26470739 CTTACTTTTCTAGTTCCTTTAGG - Intergenic
1137025201 16:35467099-35467121 TTTACTTCCTTTTTTCCTTTAGG + Intergenic
1137558285 16:49486870-49486892 TGTACTTTATTTGGTGCTTTTGG + Intergenic
1137656434 16:50163313-50163335 TTTACTTTCTTGTTTGTTTGGGG + Intronic
1138121814 16:54406196-54406218 TCTTCTTTCTTACTTTCTTTTGG - Intergenic
1138509034 16:57497334-57497356 TTTGCTTTATTAGATCCTTTGGG + Intergenic
1138694572 16:58800036-58800058 CTTACTTTTTTAGTTTCTTAAGG + Intergenic
1138934666 16:61704406-61704428 TTTTCTTTCTCAGTATCTTTGGG - Intronic
1139131767 16:64155239-64155261 TATTCCTTCTCAGTTGCTTTTGG - Intergenic
1139205165 16:65021862-65021884 TTTTTTTTCTGAGTTACTTTAGG - Intronic
1139969898 16:70767634-70767656 TTAACTTTATTAGTTGCAGTTGG - Intronic
1140049383 16:71466316-71466338 TTTAGTTTCTTGTTTGGTTTTGG - Intronic
1140506689 16:75478045-75478067 TTTCCTATTTTAATTGCTTTAGG - Exonic
1142402203 16:89865437-89865459 TTTATTTTAGTGGTTGCTTTAGG - Intronic
1142817887 17:2441745-2441767 TTTATTTTTTAAGTTGCCTTGGG - Intronic
1142991541 17:3734537-3734559 TTTACTTTCTCAGTGTCTTAGGG + Intronic
1143852773 17:9825129-9825151 TTTACTTGCTGTGTGGCTTTGGG + Intronic
1144796766 17:17896694-17896716 TTTACTTTCTCCATGGCTTTTGG - Intronic
1145180030 17:20740658-20740680 TTTACTGTATTATTTGATTTTGG + Intergenic
1146664572 17:34689304-34689326 TCTATTTTCTTAGTTTGTTTAGG - Intergenic
1146959446 17:36960580-36960602 TTAAATTACTTAGTTGCCTTAGG + Intronic
1147201529 17:38805274-38805296 TTTTCTTTCTTTGTTTTTTTTGG - Intronic
1148551582 17:48553524-48553546 TCTTGTTTCTTATTTGCTTTGGG - Exonic
1149273862 17:55013471-55013493 GGAACTCTCTTAGTTGCTTTAGG + Intronic
1150538772 17:66075402-66075424 TTTTCTTTATTGGTTGCTTTTGG - Intronic
1150664214 17:67116138-67116160 ATTATTTTGCTAGTTGCTTTAGG - Intronic
1151282873 17:73089597-73089619 TTTACAGCCTTAGTTGCTTGAGG + Intronic
1152154010 17:78621353-78621375 TTTATTTTCTTTTTTGCTTTTGG - Intergenic
1152970562 18:157735-157757 ATTACTATTTTAGTTGTTTTGGG - Intergenic
1154219749 18:12441589-12441611 TATACATTCTTCTTTGCTTTGGG - Intergenic
1154388365 18:13915833-13915855 TTTAATTCCTTAGTTCTTTTTGG - Intergenic
1154949871 18:21199511-21199533 TCTTCTTTCTTTGATGCTTTAGG - Intergenic
1155088703 18:22484607-22484629 TTTGCTGTCATATTTGCTTTAGG + Intergenic
1155417319 18:25613119-25613141 GTTTTTTTTTTAGTTGCTTTAGG - Intergenic
1156143795 18:34150011-34150033 TTTACTACCTAAGTTGCCTTGGG + Intronic
1156432279 18:37088619-37088641 TTCACTTTCTTACTTGCTTATGG + Intronic
1156709293 18:39924245-39924267 TTTAATTTCTTAGTTTGCTTTGG - Intergenic
1156831495 18:41497469-41497491 TTAACTTTTTTAGATGTTTTAGG + Intergenic
1157140734 18:45103569-45103591 TTTACTTCCTTTTTTTCTTTGGG + Intergenic
1157331806 18:46709456-46709478 TTTCCTATCTTAGTTCTTTTGGG - Intronic
1158797654 18:60866946-60866968 GTTAATTTCCTTGTTGCTTTGGG + Intergenic
1159132800 18:64299605-64299627 TTTAAATTCTTGGTTTCTTTGGG + Intergenic
1159226642 18:65546261-65546283 TTTGCTTTTTTATTTGCTTTCGG + Intergenic
1159296053 18:66490290-66490312 TATACTTTCTTATTTGTTTCAGG - Intergenic
1159301461 18:66576026-66576048 TTTATTTTAGTAGTTGCTTTAGG - Intronic
1159485284 18:69047956-69047978 TTTAATCTGTAAGTTGCTTTGGG - Intronic
1159553560 18:69921891-69921913 TTTTGTTTCTTTGTTTCTTTTGG + Intronic
1159789090 18:72754162-72754184 TTTACTTTCTTAGTTGCTTTAGG - Intronic
1160061924 18:75537378-75537400 TTTAATTTTTTAGATGCTATGGG + Intergenic
1160112691 18:76048508-76048530 TTTACCTTCTTGTTTCCTTTTGG + Intergenic
1160469845 18:79120445-79120467 ATTTCTTTTTCAGTTGCTTTTGG + Intronic
1162002434 19:7754802-7754824 TTTACATTCCTAGTTCCTTGAGG + Intergenic
1163608605 19:18289532-18289554 TTTTGTTTCTTGGTTGTTTTGGG + Intergenic
1163817193 19:19473990-19474012 ATTACTTTCTGATTTGTTTTTGG - Intronic
1165704215 19:37963722-37963744 TCTACTTTCATTGTTGATTTTGG + Intronic
1166263073 19:41656626-41656648 TTGAATTTGTAAGTTGCTTTTGG - Intronic
1166622950 19:44320108-44320130 CTTACTTTTTTAGTTCCTTGAGG + Intergenic
1167962668 19:53119496-53119518 CTTGCTTTCTTAGTTCCTTGAGG - Intronic
1168346288 19:55651652-55651674 TTTACTTTCTTTTTTTTTTTTGG + Intronic
926480001 2:13380360-13380382 TTTTCTTTTCTAGTTCCTTTAGG - Intergenic
926521269 2:13917965-13917987 TTTATTTACTTACTTGTTTTGGG - Intergenic
926610897 2:14945424-14945446 TTTCCTTGCTTTGTTTCTTTGGG - Intergenic
927349560 2:22093094-22093116 TTTATTTTTCTAGTTGCTCTAGG + Intergenic
927390396 2:22588332-22588354 TTTACTACCTTAGTTCATTTGGG - Intergenic
927995583 2:27483367-27483389 TCTCCTTTTTTAGTTGCTCTGGG - Exonic
928639230 2:33280410-33280432 CTTACTATCTTATTTGGTTTTGG - Intronic
928971276 2:37032262-37032284 TTTACTTACTTCCTTACTTTAGG + Intronic
929299595 2:40287950-40287972 TTTATTTTCCTGGTTGCTTCAGG - Intronic
929349754 2:40935919-40935941 TTTTCTTCCCTTGTTGCTTTAGG + Intergenic
930216384 2:48701512-48701534 CTTGCTCTCTTAGTTCCTTTAGG + Intronic
930602839 2:53461431-53461453 GTTCCTTTCCCAGTTGCTTTAGG - Intergenic
930661638 2:54060489-54060511 TTTACTGTCTTTGTTTCTTCTGG + Intronic
931562539 2:63578295-63578317 TTTACTTTTTGAGTTATTTTCGG - Intronic
932051096 2:68398605-68398627 TTTACGTTCTTTGTAGATTTTGG + Intergenic
932872712 2:75419422-75419444 TTTAGCTTCTCACTTGCTTTTGG - Intergenic
932917910 2:75876990-75877012 AGGACCTTCTTAGTTGCTTTAGG - Intergenic
932997928 2:76880016-76880038 TCTACTTTCTTAGCTCCATTAGG - Intronic
933132688 2:78692232-78692254 TTTTTTTTCTCAGTTGATTTTGG - Intergenic
933333384 2:80923044-80923066 TTTTGTTTCTTAGTTTGTTTTGG + Intergenic
933544257 2:83690182-83690204 TTTGGTTACTTATTTGCTTTGGG + Intergenic
933934169 2:87187339-87187361 TTTAGTTTCCCATTTGCTTTTGG + Intergenic
934173644 2:89560256-89560278 TTTATTTATTTATTTGCTTTTGG + Intergenic
934283958 2:91634605-91634627 TTTATTTATTTATTTGCTTTTGG + Intergenic
935266184 2:101396170-101396192 GTTTCTTTCTTAGTTGATCTTGG - Intergenic
935817944 2:106864855-106864877 TTTACTGTCGGAGTTCCTTTTGG - Intronic
935861149 2:107331221-107331243 TTTACTCTATAAATTGCTTTGGG - Intergenic
935978731 2:108605770-108605792 TTTTCTTTCCAAGTTGCTCTTGG - Intronic
936000322 2:108821573-108821595 TTTCCTTTCTTACTGCCTTTGGG - Intronic
936358973 2:111778556-111778578 TTTAGTTTCCCATTTGCTTTTGG - Intronic
936579127 2:113681265-113681287 TTTAGTTTATTATTTGCTTTTGG - Intergenic
936748124 2:115605395-115605417 TTTAATTTATTACCTGCTTTTGG + Intronic
936805016 2:116320779-116320801 TTTTCTCTCTTATTTGCTTCTGG - Intergenic
936931836 2:117797887-117797909 TCTACTTTCTTTGTTGGTTTGGG - Intergenic
937083018 2:119153880-119153902 TTTAATTTCCTAATTGCTTTTGG - Intergenic
937575251 2:123412647-123412669 TTTATTTTCCTAGTTTCTTGTGG - Intergenic
938179530 2:129167922-129167944 GTTACTTTAATGGTTGCTTTAGG - Intergenic
939119182 2:138095693-138095715 TTTATTTTTGTATTTGCTTTTGG + Intergenic
939380356 2:141427158-141427180 TTTAATGCCTAAGTTGCTTTTGG - Intronic
939570669 2:143836720-143836742 TTTTCTTTGTTATTTGATTTTGG - Intergenic
940112325 2:150168460-150168482 ATAATTTTCTTAGTTCCTTTTGG - Intergenic
940391575 2:153138591-153138613 TTGACTTGATTAGATGCTTTTGG - Intergenic
940455485 2:153893153-153893175 TCTCCTTTCTTAGCTGCTATTGG - Intronic
940515629 2:154680926-154680948 TTTCCTTTCTCATTTTCTTTTGG + Intergenic
940761838 2:157747194-157747216 TTCATTTTCTTAGCAGCTTTAGG - Intronic
941052634 2:160751684-160751706 TTTAATTTATTACTGGCTTTAGG + Intergenic
941168441 2:162108689-162108711 TTTACTTTCTTTTTTTCTCTTGG - Intergenic
941221806 2:162791351-162791373 TTGAATTTCTAAATTGCTTTGGG + Intronic
941509482 2:166387784-166387806 TTCACTTCCCTAGTTTCTTTAGG - Intergenic
941527558 2:166625127-166625149 TTGAATCTCTAAGTTGCTTTGGG + Intergenic
941662053 2:168204942-168204964 TTTGCCTTCTTAATTGTTTTTGG - Intronic
942174235 2:173315947-173315969 ATTATTTTCATACTTGCTTTAGG + Intergenic
942310119 2:174648686-174648708 TGTATATTCTTTGTTGCTTTGGG - Intronic
942713755 2:178867703-178867725 TTTAGTTTTTTAGTTGCATTAGG + Intronic
943123823 2:183771843-183771865 TTTACTGTCTTAGTCCCTTCTGG + Intergenic
943316226 2:186391361-186391383 TTTAATCTCTAAATTGCTTTGGG - Intergenic
943341611 2:186689411-186689433 TTTATTTTGTTAGCTCCTTTAGG + Intergenic
943343854 2:186713769-186713791 TTTTCTTGCTTTCTTGCTTTAGG - Intronic
943490815 2:188554202-188554224 CTTACTTTCCTAGTTCCTTAAGG + Intronic
944150299 2:196551093-196551115 TTTAACTTCTTAGTTGCCTTTGG - Intronic
944451489 2:199848030-199848052 TTTACTGTCTGAAATGCTTTAGG + Intronic
945242476 2:207688623-207688645 TTTACTGTCTCAGTTTCTTGGGG - Intergenic
945494470 2:210493359-210493381 ATTACTTTATAACTTGCTTTGGG - Intronic
945791043 2:214305943-214305965 TTTAATTTATAAATTGCTTTGGG + Intronic
945919257 2:215738676-215738698 TTTAAGTTATTAGTTGCTTTGGG - Intergenic
946076266 2:217076313-217076335 TTTATTTTTATAGTTGCTTTGGG - Intergenic
946207928 2:218124276-218124298 TTTACTTACTGAGTTGATTCAGG + Intergenic
946259523 2:218474980-218475002 TTTCCTTTCTTTGATGCTTTGGG + Intronic
946565415 2:220959179-220959201 TTGACTTTCTCAGTTATTTTTGG - Intergenic
946803810 2:223449916-223449938 TTTTCTCTCCTAGTTGCTTTTGG - Intergenic
947898427 2:233697630-233697652 TTTGCTTTTTTAGTTCCTTGAGG + Intronic
948298107 2:236879059-236879081 TTCACTTTCTTATTTGATATAGG + Intergenic
948398544 2:237665576-237665598 TTTATTTTTGTAGTTGTTTTTGG - Intronic
948683158 2:239651062-239651084 TTCAATTTCTTAATTGTTTTAGG - Intergenic
948871873 2:240804830-240804852 TGTGCTTTGTTAGGTGCTTTGGG - Intronic
1169901794 20:10560678-10560700 TCTAATTTTTTATTTGCTTTAGG + Exonic
1170755396 20:19200226-19200248 TTTTTTTTTTTAGTTCCTTTAGG + Intergenic
1170998945 20:21395169-21395191 TTTATTTTCTCAGTTGATGTTGG + Intergenic
1171082703 20:22204117-22204139 TTTATTTGTTTAGTTTCTTTTGG + Intergenic
1171130344 20:22646809-22646831 TTTACTCTCTTCTTTACTTTTGG + Intergenic
1171302063 20:24071770-24071792 TTTACTATCTTAGCTGCCTGAGG - Intergenic
1171505516 20:25629906-25629928 TTTCCTATCTAAGTTGCTTCAGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172382148 20:34503821-34503843 TTTTGTTTGTTGGTTGCTTTTGG + Intronic
1172850704 20:37961408-37961430 TTTTCTCTCTGTGTTGCTTTGGG + Intergenic
1173321895 20:41995582-41995604 TTTCCTTTTTTAGTTTCTTTAGG + Intergenic
1173419398 20:42887492-42887514 TTTATTTTCTTAGTCAATTTAGG - Intronic
1173953113 20:47008641-47008663 TTTACTGTCTCAGTTACTTTTGG + Intronic
1174370111 20:50081060-50081082 TTTAATGTTTTAGATGCTTTGGG - Intergenic
1174776594 20:53348557-53348579 TTTTGTTTCTTTGTTTCTTTTGG - Intronic
1174908490 20:54578802-54578824 TTTATTTTCTTTGTTGCTTGCGG + Intronic
1175660812 20:60810421-60810443 TTTTCTCTCTTAGTTTCTGTGGG + Intergenic
1177054163 21:16279225-16279247 TTTATTTTCTTATTTTATTTTGG - Intergenic
1177086257 21:16709019-16709041 GTTTCTTTCTTAGCTGCATTGGG - Intergenic
1177685141 21:24426442-24426464 TTTACTTTCTGAGTTTCTGGAGG - Intergenic
1177909715 21:27016252-27016274 TTTACTTTCTAAGTATCATTGGG - Intergenic
1178025942 21:28467013-28467035 TTTATTTTGTTAGGTACTTTGGG - Intergenic
1178072211 21:28980932-28980954 TTTACTTTTTTATTTAGTTTGGG - Intronic
1179214626 21:39356493-39356515 TTTCCTTTTTTAGTTCCTTGAGG - Intergenic
1179615122 21:42578794-42578816 TCTATTTTCTTAGGTGCTTGTGG - Intronic
1182203051 22:28593069-28593091 ATTAATTTCATAGTAGCTTTTGG + Intronic
1182347871 22:29679504-29679526 GTTACTATCTTAGTTTGTTTTGG + Intronic
1182941770 22:34283769-34283791 TTTTCTTTCTTAATTCATTTGGG + Intergenic
1184705131 22:46206483-46206505 GTTATTTTAGTAGTTGCTTTAGG + Intronic
1184966705 22:47980260-47980282 TTTACTTTCTTGATTTCTTCTGG + Intergenic
1185264632 22:49894271-49894293 TTTCCTTTCTTACCTTCTTTGGG - Intergenic
949114805 3:308136-308158 TTTAATTTCTGAGTTGTCTTTGG + Intronic
949186643 3:1199876-1199898 TTTATTTTATTTGTTTCTTTTGG - Intronic
949605216 3:5645488-5645510 TTTGCGTTCTTAGCTGCCTTAGG + Intergenic
949630797 3:5924078-5924100 TTTACTTTCTGTGTTGTTTAAGG + Intergenic
949834427 3:8252700-8252722 TTTAGTTTCTTGTTTGCTTATGG - Intergenic
950690721 3:14654513-14654535 TTTACCTTGTTAGTTGTTTTTGG - Exonic
951136998 3:19115900-19115922 TCTACTTTCTTAATTTTTTTTGG + Intergenic
951388541 3:22073271-22073293 TTTATTTTCTAAATTACTTTAGG + Intronic
951399898 3:22219106-22219128 GTTACTTTCTTAGCTCTTTTTGG + Intronic
951439347 3:22705434-22705456 TCTACTTTTCTAGTTGCTTGGGG - Intergenic
951676671 3:25249733-25249755 TTTCCTTTCTTAGTTACATAGGG + Intronic
951830622 3:26922280-26922302 TTTGCTTTCCTAGTTTTTTTGGG + Intergenic
951987204 3:28633881-28633903 TTTCCTTCCTTTGTTTCTTTGGG + Intergenic
952235135 3:31471504-31471526 TTTACTTGCTTATTTCCTTTGGG - Intergenic
952546567 3:34426425-34426447 TTTAATCTTTAAGTTGCTTTGGG - Intergenic
953283932 3:41586956-41586978 TTTATTATCTTAGTTTCTGTAGG + Intronic
955456112 3:59123325-59123347 TTGGCATGCTTAGTTGCTTTCGG - Intergenic
955533234 3:59896494-59896516 TTTAATTTCTGAGTTACTCTTGG - Intronic
956197391 3:66666588-66666610 CATAATTTCTTAGTTGATTTTGG - Intergenic
957014924 3:75052029-75052051 TTTACTTTCAAAGTTGCCTTGGG + Intergenic
957235597 3:77585123-77585145 TTTCCTTTCATAGTTTTTTTTGG + Intronic
957302443 3:78409839-78409861 TTTACTTATTTATTTTCTTTTGG - Intergenic
957355108 3:79073314-79073336 TTTAATTCCTTAGTTGCATGAGG + Intronic
957421050 3:79970448-79970470 TTTCCTTTCTTCCTTTCTTTTGG - Intergenic
957551121 3:81706241-81706263 TTGACATGCTTAGTTGCTTTAGG - Intronic
957624056 3:82635985-82636007 TTTGCTTTCTTGTATGCTTTTGG - Intergenic
957647760 3:82955067-82955089 GCTACTGTCATAGTTGCTTTGGG - Intergenic
957779021 3:84794172-84794194 TTTACATTATCATTTGCTTTGGG - Intergenic
957800225 3:85068777-85068799 TTTAATTTTTTTTTTGCTTTTGG + Intronic
958460495 3:94388540-94388562 CTTATTTTTTTAGTTCCTTTAGG - Intergenic
958524163 3:95232068-95232090 TTTAGTTTGTTAGAAGCTTTTGG - Intergenic
958561268 3:95749921-95749943 TTTACTTTATTACTTCTTTTGGG + Intergenic
958874046 3:99595275-99595297 TTTACTTTGTTTCTTGTTTTCGG + Intergenic
958985195 3:100772568-100772590 ATTATTTTCATGGTTGCTTTGGG - Intronic
959154984 3:102656189-102656211 TTTACTTTCTTATTTTGTGTGGG - Intergenic
959272569 3:104231916-104231938 TCTACCTTCTTATTTGTTTTAGG - Intergenic
959340992 3:105130884-105130906 TTTACTTTCAAAGTTGATATTGG + Intergenic
959478454 3:106840617-106840639 TTTTCTCTCTTAGTTGCTTAGGG + Intergenic
959899484 3:111643910-111643932 TTGAATTTCTAAATTGCTTTTGG - Intronic
959955011 3:112226770-112226792 CTTACTTTTTTAGTTCCTTAAGG - Intronic
960303354 3:116031579-116031601 TTTTTTTTTTTAGTTGCTTAAGG + Intronic
960370579 3:116832928-116832950 AGTACTTTCTTTGTTTCTTTTGG - Intronic
960561657 3:119090847-119090869 TTTGTTTTTATAGTTGCTTTTGG - Intronic
961096367 3:124159980-124160002 TTCAATTTCTTATTTTCTTTGGG - Intronic
961489667 3:127245897-127245919 TTTTCTTTCTTTCTTGCCTTAGG - Intergenic
961911367 3:130319942-130319964 TTTACTTTCTCAGAGACTTTAGG + Intergenic
962411702 3:135146572-135146594 CTTACTTTCTAGGTTGCTTCAGG + Intronic
962925182 3:139986618-139986640 TTAAATTTCTCTGTTGCTTTTGG + Intronic
963208210 3:142657984-142658006 TTTCCTTTATTAGTGGCTTGTGG + Intronic
963279884 3:143373586-143373608 TTTACTATTTCAGTGGCTTTGGG - Intronic
963632655 3:147752379-147752401 TGTTCTTTCTTAGTTCCTTCAGG + Intergenic
963982235 3:151551483-151551505 TTTTCTTTCTTTTTTGTTTTTGG - Intergenic
964796603 3:160504532-160504554 TTTATTTTCGTATTTGTTTTTGG + Intronic
964838679 3:160969753-160969775 TTCCCTTTATTAGTTTCTTTTGG - Intronic
964948547 3:162257580-162257602 TTTAATTTATAAATTGCTTTGGG + Intergenic
964986578 3:162748152-162748174 TTTATTTTGTTACTTGCTATTGG + Intergenic
965001745 3:162962980-162963002 TTTAAGTTCTTAGTAGATTTTGG - Intergenic
965134902 3:164751332-164751354 TTTAGTTTCATATTTGTTTTAGG - Intergenic
965179379 3:165382348-165382370 TTTAATTGCTCAGTTGCTTCAGG - Intergenic
965377551 3:167944313-167944335 TTTACATTCTTATTTTATTTTGG - Intergenic
965461162 3:168965138-168965160 ATTTCTTTTTTAGTTGATTTTGG + Intergenic
965495099 3:169388496-169388518 TTTCCTTTCTTCGTTTCTTTGGG - Intronic
966157968 3:176937957-176937979 TTTACTTTCTTTGTCTCTCTGGG - Intergenic
966197483 3:177327775-177327797 GTTTCTTTCTTTGTTGGTTTGGG - Intergenic
966531615 3:180988103-180988125 TTTACTTATTCTGTTGCTTTTGG - Intronic
966845951 3:184129966-184129988 TTTATTTTTCTAGTTACTTTGGG - Intergenic
967752800 3:193133509-193133531 TTTTCTTTCTTAGTTCCTGAAGG + Intergenic
968777408 4:2551795-2551817 TTTGCCTTATTATTTGCTTTGGG + Intronic
969827495 4:9769085-9769107 TTTATTTATTTATTTGCTTTTGG + Intergenic
970654908 4:18220191-18220213 TTTACTTTCTTTGTAGATTCTGG + Intergenic
970706519 4:18810483-18810505 TTTACTTGGTTGGTTTCTTTAGG - Intergenic
971114121 4:23623479-23623501 TTTAATTTTTTAGTTCCTCTAGG - Intergenic
971731909 4:30395207-30395229 TTCACTTTCTTAATATCTTTAGG + Intergenic
971985433 4:33816390-33816412 TTTACATTGTAACTTGCTTTAGG - Intergenic
971989768 4:33877294-33877316 TTGAATTTCTAAATTGCTTTGGG + Intergenic
972055959 4:34804127-34804149 TTTAGTACCTTAGTTCCTTTTGG + Intergenic
972124456 4:35745703-35745725 TTGACTTTTTAAATTGCTTTGGG - Intergenic
972738775 4:41870704-41870726 TTTTCTTTCTTTCTTTCTTTTGG + Intergenic
973056071 4:45659568-45659590 TTTAATTTCTCAGTTTCTATGGG + Intergenic
974283645 4:59834675-59834697 TTTAGATTCTTAATTTCTTTTGG - Intergenic
974450160 4:62044751-62044773 TTTATTTTCTAATTTCCTTTTGG - Intronic
974467609 4:62277175-62277197 TTTCTTTTTTTATTTGCTTTTGG - Intergenic
974691424 4:65302199-65302221 TTTAATTTCTTAGTTTTTCTGGG - Intergenic
974879685 4:67739683-67739705 AGTATTTTCTTAGTTGCATTTGG + Exonic
975093278 4:70427722-70427744 TTAAATTTATAAGTTGCTTTGGG - Intergenic
975422496 4:74184045-74184067 GTTATTTTCATGGTTGCTTTCGG - Intronic
975799850 4:78049035-78049057 GTTACTTTCTGTGTTACTTTGGG - Intergenic
976033836 4:80792331-80792353 TGAACTTTCTGAGTTGCGTTAGG + Intronic
976121166 4:81783974-81783996 TTTAATTTCTTTTTTCCTTTTGG + Intronic
977054300 4:92170441-92170463 TATATTTTCTTAATTGCCTTAGG + Intergenic
977329325 4:95617621-95617643 TTGAATCTCTAAGTTGCTTTGGG - Intergenic
977390154 4:96398859-96398881 TCTACTTTCTTTGTTGTTTGGGG + Intergenic
977517999 4:98046395-98046417 TTGACTCTCTTTATTGCTTTTGG + Intronic
978173818 4:105706096-105706118 CTTATCTTCTTTGTTGCTTTTGG + Intronic
978353821 4:107848919-107848941 TTTTCTTTCTTTCATGCTTTTGG + Intronic
978586565 4:110281262-110281284 GGAACTCTCTTAGTTGCTTTAGG + Intergenic
979433620 4:120662654-120662676 TTTCCTTTGTTGGTTGCTTTTGG + Intergenic
979455907 4:120925396-120925418 CTTACTTTCAGATTTGCTTTTGG + Intergenic
979687349 4:123525508-123525530 TTTAGCTTGTAAGTTGCTTTGGG - Intergenic
979871069 4:125822677-125822699 TCAATTTTCTTAGTTGTTTTAGG - Intergenic
980335903 4:131473009-131473031 TCTACTTTCCTACTAGCTTTTGG + Intergenic
980543426 4:134225808-134225830 TTGAATTTCTAGGTTGCTTTGGG - Intergenic
980669190 4:135981777-135981799 TTGGCTTTTTTAGTTGGTTTTGG + Intergenic
980750875 4:137086222-137086244 TTTACTTTATTTGGTGCTATTGG + Intergenic
981196230 4:141924199-141924221 TTTACATTCTTATTAGCCTTAGG - Intergenic
981469122 4:145109925-145109947 TTTTCTTTCTTTGCTGCTATAGG + Intronic
981827931 4:148965168-148965190 ATCACTTTCTTAATTTCTTTTGG - Intergenic
982183276 4:152769670-152769692 TTTACTTTCTTTGGTGCATATGG + Exonic
982584409 4:157220113-157220135 TTTGCTTGCTTGTTTGCTTTCGG + Intronic
983170668 4:164532346-164532368 TTTGATATCTTAGTTTCTTTGGG - Intergenic
983387143 4:167079591-167079613 TTTTCTTTCTTATGTGTTTTTGG - Intronic
983455720 4:167961477-167961499 TTTGCTTTTTTAGTTCCTTTAGG - Intergenic
983579429 4:169292867-169292889 TTTACTCTCTTGTTTGCTTGAGG - Intergenic
984043901 4:174773452-174773474 TTTGTTTTCTTACTTGCTCTAGG - Intronic
984057491 4:174948342-174948364 TTTATCTTCTTTGTTGCTCTTGG + Intronic
984112308 4:175632599-175632621 TTTTCTTTCTGAATTGCATTAGG + Intergenic
984401033 4:179264060-179264082 TTTACTTTTCTAGTTACTTGAGG - Intergenic
986099356 5:4592728-4592750 TTTTCTTTCTCAGTTTCTTGTGG + Intergenic
986595641 5:9418916-9418938 TGTTCTTTCCTAGTTCCTTTAGG + Intronic
986620487 5:9667738-9667760 TTTATTTTCTTTGATGCTCTTGG - Intronic
987697136 5:21346487-21346509 TTTTTTTTCCTAGTTCCTTTAGG + Intergenic
987698294 5:21361039-21361061 TTTACTTTTTTATTTTGTTTTGG + Intergenic
987827960 5:23058304-23058326 TTCAATTTATTAGTTCCTTTTGG + Intergenic
987900829 5:24009661-24009683 TTTAATTTCTTAATTTCATTTGG - Intronic
987966660 5:24886128-24886150 TGTCCTTTCTTATTTCCTTTTGG - Intergenic
988299862 5:29408561-29408583 TTTACATTCTTATTTGTTTCAGG - Intergenic
988754358 5:34230487-34230509 TTTACTTTTTTATTTTGTTTTGG - Intergenic
989054981 5:37358068-37358090 TTTTATTTCTTACCTGCTTTTGG + Exonic
989157426 5:38357430-38357452 CTTACTGTCTTAGTCTCTTTGGG - Intronic
989439052 5:41448443-41448465 TCAATTTTCTTAGTTACTTTTGG - Intronic
990907562 5:60820164-60820186 TTTACTTTTTTTGTGGCTGTAGG - Intronic
991334382 5:65530648-65530670 TTTGTTTTCATAGTTACTTTAGG - Intronic
991386512 5:66096187-66096209 TTTATTTTTTTAGTTTCCTTGGG + Intergenic
991742135 5:69691334-69691356 TTTACTTTTTTATTTTGTTTTGG - Intergenic
991743322 5:69705890-69705912 TTTTCTTCCCTAGTTCCTTTAGG - Intergenic
991754377 5:69849313-69849335 TTTTCTTCCCTAGTTCCTTTAGG + Intergenic
991755558 5:69863874-69863896 TTTACTTTTTTATTTTGTTTTGG + Intergenic
991793709 5:70271074-70271096 TTTACTTTTTTATTTTGTTTTGG - Intergenic
991794895 5:70285626-70285648 TTTTCTTCCCTAGTTCCTTTAGG - Intergenic
991803996 5:70406064-70406086 TTTTCTTCCCTAGTTCCTTTAGG + Intergenic
991821526 5:70566638-70566660 TTTACTTTTTTATTTTGTTTTGG - Intergenic
991822706 5:70581201-70581223 TTTTCTTCCCTAGTTCCTTTAGG - Intergenic
991833702 5:70724461-70724483 TTTTCTTCCCTAGTTCCTTTAGG + Intergenic
991834885 5:70739022-70739044 TTTACTTTTTTATTTTGTTTTGG + Intergenic
991886087 5:71270606-71270628 TTTACTTTTTTATTTTGTTTTGG - Intergenic
991887269 5:71285164-71285186 TTTTCTTCCCTAGTTCCTTTAGG - Intergenic
991949582 5:71934198-71934220 TTTATTTTTGTAGTTGCTCTAGG + Intergenic
992248987 5:74858462-74858484 CTTACTTTGTTAATTCCTTTAGG - Intronic
992714510 5:79496707-79496729 TTTAGTTTCTTATTTCATTTTGG - Intronic
992800910 5:80295182-80295204 TTTTCTTTCTTACTTCCTCTGGG - Intergenic
992814601 5:80423854-80423876 TTTATTTTCCTACTTGTTTTAGG + Intronic
992930792 5:81642931-81642953 TTTTCATTCTTATTTGCTTCTGG + Intronic
993074452 5:83211054-83211076 TTTAGATTCATAGTTGATTTGGG - Intronic
993372071 5:87105246-87105268 ATTACTGTCTTATTTTCTTTAGG - Intergenic
993785785 5:92133717-92133739 TTCAATTTGTTAATTGCTTTGGG + Intergenic
994348136 5:98712299-98712321 TTTAGTTTCATATTGGCTTTGGG + Intergenic
994612596 5:102063308-102063330 TTTTCTTTCTTAGAGGATTTTGG + Intergenic
995058396 5:107787760-107787782 TTTTCTGTCTTAGTTTATTTGGG - Intergenic
995143596 5:108761497-108761519 ATTACTATCTTAATTGTTTTGGG - Intronic
995462216 5:112415898-112415920 TTGCCTTTTTTACTTGCTTTAGG - Intronic
996143631 5:119946251-119946273 CTTACTTTCCTAGTTCCTTCAGG - Intergenic
996785963 5:127237024-127237046 ATTTCTTTCTTAGTTTCTTTGGG - Intergenic
996982056 5:129509873-129509895 TGTACTTTCTTACTTCCCTTAGG + Intronic
996995859 5:129696047-129696069 TTTTCTTTCTTAATCTCTTTGGG + Intronic
997144667 5:131419983-131420005 TTCAGTTTTTTAGTTGCTTCAGG - Intergenic
997290496 5:132729856-132729878 TTTTTTTTCTTACTTACTTTGGG - Intronic
997391026 5:133516414-133516436 TTTATATTTTTGGTTGCTTTTGG - Intronic
997908667 5:137846311-137846333 TTTTCTTGCTTGCTTGCTTTCGG - Intergenic
999025485 5:148226438-148226460 TCTAGTTTATTAGTTGTTTTAGG - Intergenic
1000132400 5:158312831-158312853 TTTACTTTGTGATTTGCTTTGGG - Intergenic
1000404486 5:160872940-160872962 TTGAATTTCTAAATTGCTTTTGG + Intergenic
1000456283 5:161453652-161453674 CTCACTGTCTTAGTTGATTTGGG - Intronic
1000985035 5:167856974-167856996 TGTACTTTGTTAGGAGCTTTGGG + Intronic
1001305115 5:170566797-170566819 TTCAATTTCTCAGGTGCTTTGGG - Intronic
1001376025 5:171259375-171259397 TATACTATCTTATTTTCTTTTGG - Intronic
1001741065 5:174053113-174053135 TTTACTTACTGTGTAGCTTTAGG + Intronic
1002479443 5:179490262-179490284 TTTATTTTCTTAGATTCTTTGGG - Intergenic
1002993027 6:2255534-2255556 TTTATTATCTTAGTTTCTGTGGG + Intergenic
1003250024 6:4419261-4419283 TTTTCTTTCTTTGCTGATTTTGG - Intergenic
1004060054 6:12186019-12186041 TTTAGATTTTTACTTGCTTTTGG - Intergenic
1004060056 6:12186120-12186142 TTTAGATTTTTACTTGCTTTTGG - Intergenic
1004614562 6:17278411-17278433 TTTGCTTTGTCAGCTGCTTTTGG - Intergenic
1005552543 6:26937342-26937364 TTTACTTTTTTATTTTGTTTTGG - Intergenic
1006476207 6:34256088-34256110 GTTACTTTATTAGTTACTTTAGG - Intergenic
1006614337 6:35315687-35315709 TTTACATTCTTTGTAGCTGTTGG + Intronic
1007233550 6:40371140-40371162 TTTTCTTGCCTAATTGCTTTGGG + Intergenic
1007242108 6:40433624-40433646 TTTACATTCTTAATTGGTTTAGG + Intronic
1007492177 6:42231759-42231781 TTTACTTTGTTTTTTGCTTTAGG - Intronic
1008194298 6:48499093-48499115 TTTACTTTCCAAGTTTATTTTGG + Intergenic
1008295497 6:49771155-49771177 TTTATTTTATTATTTGTTTTAGG + Intergenic
1008413193 6:51207206-51207228 TTTATTTTCTTGGCTGCTGTGGG - Intergenic
1008772813 6:55000060-55000082 TTTACTTTCTTAGTCCACTTGGG + Intergenic
1008874267 6:56308413-56308435 TTTATTGTCTTAGTCCCTTTGGG - Intronic
1008913341 6:56760070-56760092 GTTATTTTCTTTTTTGCTTTTGG - Intronic
1009589424 6:65647088-65647110 TTTAATTTGTAGGTTGCTTTTGG - Intronic
1009753514 6:67903718-67903740 TTTAATCTATAAGTTGCTTTTGG - Intergenic
1010169622 6:72959724-72959746 ATCACTTTTTAAGTTGCTTTGGG + Intronic
1010411202 6:75563691-75563713 TTCATTTTCTGAATTGCTTTAGG - Intergenic
1010811238 6:80301119-80301141 TTTTCCTTCCTAGTTCCTTTAGG - Intronic
1011063425 6:83297383-83297405 TTTAATTTCTAAATTGCTTTGGG - Intronic
1011099246 6:83704074-83704096 TTTACTTTATTATTTGACTTGGG + Intronic
1011199195 6:84816640-84816662 ATTAAGTTCTTAGTAGCTTTTGG - Intergenic
1011582000 6:88878537-88878559 TTTACTTTTTTAATTGTTCTGGG - Intronic
1012001546 6:93661231-93661253 TGAATTTTCTTAGTTGATTTTGG + Intergenic
1012652540 6:101773810-101773832 TTTAATTTCTTAGTGGCAATGGG - Intronic
1012688232 6:102279110-102279132 TTTAATTTATAAATTGCTTTGGG + Intergenic
1013143688 6:107365337-107365359 GTTATTTTCCTAGTTGTTTTGGG - Intronic
1013571852 6:111435235-111435257 TTGACTTTGTAAATTGCTTTGGG - Intronic
1013656634 6:112253777-112253799 TTTCCTTTGTAAGTTGCATTTGG - Intronic
1013983468 6:116161795-116161817 TTGACTTTCTAGATTGCTTTGGG + Intronic
1014043733 6:116859731-116859753 TATACTTTCTTATTTCCTTGTGG + Intergenic
1014088709 6:117377432-117377454 TTTCTTTATTTAGTTGCTTTGGG - Intronic
1014698376 6:124652532-124652554 TTTTCTATCTTAGTTTGTTTTGG + Intronic
1014852487 6:126358987-126359009 TTTTCTTTCCTAGTTCCTCTAGG + Intergenic
1015295713 6:131589930-131589952 TATACTTTCTTAGTTCCATTTGG + Intronic
1015449362 6:133347317-133347339 TTTACTTTATTAGGTTCTTGAGG + Intronic
1015671774 6:135698992-135699014 TTTTCTTCTTTAGTTGGTTTTGG - Intergenic
1015776352 6:136818679-136818701 TTTATTGTCTTAGTTGGTTCAGG + Intergenic
1016202036 6:141422273-141422295 TTTATTTTCGTGATTGCTTTGGG + Intergenic
1016601893 6:145871620-145871642 TTGAATTTATAAGTTGCTTTGGG - Intronic
1016639605 6:146333836-146333858 TTTATTTTCCTTGTTTCTTTAGG - Intronic
1017179729 6:151540092-151540114 ATTTCTGTCTTAGTTGGTTTGGG + Intronic
1017185911 6:151600324-151600346 TTTACTGTATTAGTTTCTTAGGG + Intronic
1017263152 6:152411344-152411366 TTTACTTACTTATTTATTTTAGG + Intronic
1017275391 6:152561068-152561090 TTTGCTTGCTTAATTGATTTGGG - Intronic
1017864333 6:158429839-158429861 TTGACTTTCCAAGTTGATTTCGG - Exonic
1018349453 6:162941576-162941598 TTTACTGTCATTGTTGCTGTTGG + Intronic
1018352981 6:162981604-162981626 TTGAATTTGTAAGTTGCTTTTGG + Intronic
1019443925 7:1061159-1061181 TTCAATTTCTCAGTGGCTTTGGG + Intronic
1020349557 7:7203199-7203221 TTTTCTTTCCTAATTGCTCTGGG + Intronic
1020664887 7:11027881-11027903 TTTACTTTCTTTGTTATTTTTGG + Intronic
1020924351 7:14306292-14306314 GTTCCTTTCTTACTTTCTTTCGG - Intronic
1021132825 7:16931921-16931943 TTTACTATATTTGTTGCTTATGG + Intergenic
1021281881 7:18729730-18729752 TTCACTTTCCTATTTGTTTTTGG - Intronic
1021449444 7:20769322-20769344 TTTACTTTGTTAACTGATTTAGG - Intronic
1021496175 7:21276750-21276772 TAAACTCTCTTTGTTGCTTTGGG + Intergenic
1021836207 7:24677996-24678018 ATTACTTTCTTAGTTTAGTTTGG + Intronic
1021859815 7:24895140-24895162 TTTACTTTTTAGGCTGCTTTTGG - Intronic
1022214689 7:28247003-28247025 TTTTTTTTTTTAATTGCTTTTGG + Intergenic
1022251402 7:28611917-28611939 TTTCTTTTCTTTGTTGCTTTAGG - Intronic
1022346652 7:29522366-29522388 TTTGCTTTTTTAATAGCTTTTGG - Intergenic
1022966500 7:35478601-35478623 TTTTCTTTTTTTGCTGCTTTTGG - Intergenic
1022971211 7:35519076-35519098 TTTATTTTCTGAGCTGCTTCTGG + Intergenic
1023274099 7:38499511-38499533 TTGAGCCTCTTAGTTGCTTTGGG - Intronic
1023532876 7:41176516-41176538 TTATCTTTCTTAGCTGCATTCGG - Intergenic
1024267800 7:47620052-47620074 TTTACTGTCTTTGTTCCTTCAGG - Intergenic
1024489681 7:49965852-49965874 TTTATTTTGGTAGTTGCTTTAGG - Intronic
1024915050 7:54489943-54489965 ATTATTTTCTTAGTTCATTTGGG + Intergenic
1025821199 7:64966803-64966825 TTTAATTTACAAGTTGCTTTAGG + Intergenic
1025967271 7:66285958-66285980 TTTACGTTCTTAGTGGTTTATGG + Intronic
1026381786 7:69807385-69807407 TTTACTATCTTAGTTTATGTGGG + Intronic
1026509150 7:71013506-71013528 TTTCCTTTCTTTCTTTCTTTTGG - Intergenic
1027511211 7:79082656-79082678 TTTACTTTTCAAGTTGGTTTTGG + Intronic
1027567239 7:79810895-79810917 TTTACTTTCTTTCTTTTTTTTGG - Intergenic
1027580550 7:79989339-79989361 ATTATTTTCTTAATTGCCTTGGG - Intergenic
1027582221 7:80012552-80012574 TTTTCTTTCTTAGTTCCTTGAGG + Intergenic
1028519256 7:91711443-91711465 TTTACTTTTCTAGTTTCTTGAGG - Intronic
1028730083 7:94136775-94136797 TTTCCATTCTCACTTGCTTTGGG - Intergenic
1028863966 7:95686497-95686519 TTTACTGTCTGGGTAGCTTTAGG + Intergenic
1030086823 7:105823105-105823127 TTTATATTATTAGTTACTTTTGG + Intronic
1030422937 7:109331329-109331351 TTTTCTTTCTTTTTTGTTTTTGG + Intergenic
1030840721 7:114350642-114350664 TTTGCCTTCTTAGTTGCTACTGG - Intronic
1030843261 7:114381151-114381173 GGAACCTTCTTAGTTGCTTTAGG + Intronic
1030873899 7:114790007-114790029 TTTAGTTTCTTATTGGCTGTTGG + Intergenic
1030975096 7:116111994-116112016 TTTACTTTCTGATTTTCTCTAGG + Intronic
1031265561 7:119575392-119575414 TTTACTATGTAAATTGCTTTGGG + Intergenic
1031510005 7:122638148-122638170 TTTTCTTTCTTAGGTGTTCTGGG + Intronic
1031587283 7:123547392-123547414 TTTACTTTTTTTTTTTCTTTTGG + Intronic
1031738383 7:125396402-125396424 TCTTCTTTCTCAGTTGCTATGGG - Intergenic
1032509520 7:132461009-132461031 TTTTCTTTCTTTTTTCCTTTTGG - Intronic
1032901034 7:136308481-136308503 TTTACTTTGTTGGTTGTTTGTGG + Intergenic
1032954519 7:136955036-136955058 TTTCCTTTCTTGGTTTCTTAAGG + Intronic
1033437347 7:141345084-141345106 TGTAATTTTTTACTTGCTTTAGG - Intronic
1033794080 7:144826660-144826682 TTTATTTTTTTTGTTGCTGTTGG - Intronic
1033826503 7:145196932-145196954 TTTGCTTTTTTAGTTTCTTAAGG + Intergenic
1034076121 7:148232808-148232830 TTTACTTTCGTAGCTGGGTTTGG + Intronic
1034248583 7:149669508-149669530 TTCACTTTCTTACCTCCTTTTGG + Intergenic
1035150880 7:156871935-156871957 TTTTCTTGCCTAATTGCTTTAGG - Intronic
1035589132 8:799766-799788 TTTAATTTCTTTGTTGAGTTGGG + Intergenic
1035607062 8:936698-936720 TTTGGTTTTTTAGTTGCTGTTGG + Intergenic
1035836238 8:2755451-2755473 TTAACTTTCTATGTAGCTTTTGG - Intergenic
1036478269 8:9114441-9114463 TTAACTTTCTTAATTACTTACGG - Intronic
1036495193 8:9263870-9263892 TTTTCTTTCTCAGTTTCATTGGG + Intergenic
1036720291 8:11168046-11168068 TTTGCTTTTTTTGTTGTTTTTGG - Intronic
1037430997 8:18813101-18813123 TTTACCTTCTAAATAGCTTTCGG - Intronic
1037544663 8:19907099-19907121 TTTAATTTCTTTGTAGATTTTGG + Intronic
1037557967 8:20043851-20043873 TTTACTGTCTTAGGTGAATTGGG - Intergenic
1038317023 8:26493687-26493709 TCTGCCTTCTGAGTTGCTTTTGG - Intronic
1038436029 8:27536762-27536784 TTTGCTTTCTTGATTGTTTTAGG + Exonic
1038586666 8:28795829-28795851 GTTACTGTCTTAGTTAGTTTGGG - Intronic
1038863459 8:31412984-31413006 TTATTTTTCTTAGTTGTTTTAGG + Intergenic
1039015926 8:33148822-33148844 TTTACTTTCTTAGATGGCTGAGG + Intergenic
1039303390 8:36234829-36234851 TTCACTTTATTAGTTTCCTTGGG - Intergenic
1039444751 8:37622079-37622101 TTTTCTTTCTTTTTTTCTTTTGG + Intergenic
1039463815 8:37768353-37768375 GTTATTTTATTGGTTGCTTTGGG - Intronic
1039481287 8:37875219-37875241 TTTCCTTTCTTGGTGGCCTTCGG - Exonic
1039614432 8:38943767-38943789 TTTTATTTCTTATTTGATTTAGG + Exonic
1040911712 8:52526039-52526061 TTGAATTTGTAAGTTGCTTTGGG + Intergenic
1040938610 8:52809057-52809079 TTTACTTTTTTCTTTGCTTTTGG + Intergenic
1041046304 8:53889819-53889841 TTGACTTTCCTAGTTTCTGTTGG + Intronic
1041404002 8:57476759-57476781 TTTTCTTGTCTAGTTGCTTTGGG + Intergenic
1041453880 8:58036755-58036777 TTTGCTTCCTTATTTGCTTTAGG + Intronic
1041602238 8:59732995-59733017 TTTTTTTTTTTTGTTGCTTTTGG - Intergenic
1041735038 8:61101636-61101658 TTTATTTATTTATTTGCTTTTGG + Intronic
1041812440 8:61926637-61926659 TTTACTCACTTATTTCCTTTGGG + Intergenic
1041929505 8:63271549-63271571 TTTGCTTCCTTAGTTTCTTGAGG + Intergenic
1042015164 8:64300916-64300938 TTTACTTTCTTTAATGGTTTAGG - Intergenic
1042341340 8:67683207-67683229 TGTGTTTTCTTAGTTGTTTTAGG + Intronic
1042684159 8:71418888-71418910 CCTACTTTCTTACTTCCTTTAGG - Intronic
1042876146 8:73441487-73441509 CTTACTTTCTTTCTTTCTTTTGG - Intronic
1043123205 8:76357801-76357823 TTAACTTTGTTAGCTGTTTTAGG + Intergenic
1043276199 8:78396998-78397020 TTTTCTTTTTTAGTTTCTTAGGG + Intergenic
1043367410 8:79550504-79550526 TTTACTTTCTTGCCTGATTTAGG + Intergenic
1045399811 8:101802196-101802218 GTTACTTTTGTAATTGCTTTGGG + Intronic
1045791907 8:105993429-105993451 TTTACTTTGTTATTTACTTCTGG + Intergenic
1045904093 8:107322368-107322390 TTTAGTTTCTTGGTTTCCTTGGG + Intronic
1046212942 8:111102339-111102361 TTTTCTTTCTTAGATTGTTTTGG + Intergenic
1047187836 8:122650522-122650544 TTTCCTTTCTTAGTTTATGTAGG + Intergenic
1047551928 8:125883482-125883504 ATTATTTTCTTAGTTGGTGTGGG - Intergenic
1047969300 8:130071060-130071082 TTTTTTTTCTTAGATGATTTGGG - Intronic
1048344789 8:133568573-133568595 TTTGCTTTCCTGGTCGCTTTTGG + Intronic
1048527485 8:135216339-135216361 TTTACTTTTATACTTGCATTTGG - Intergenic
1048636519 8:136301599-136301621 TTAACGTTCTTAGGTGCTGTCGG - Intergenic
1048640703 8:136357034-136357056 CTTATTTTGTTAGTTTCTTTAGG + Intergenic
1048724392 8:137365973-137365995 TATTCTGTCTTAGATGCTTTGGG + Intergenic
1048815726 8:138332061-138332083 TTTACATTCTTGTTTGGTTTGGG + Intronic
1049327829 8:142032990-142033012 TTTAGTTTCTTAGTTTCCATAGG + Intergenic
1049998788 9:1053807-1053829 TTTACCTTCTAAAATGCTTTTGG - Exonic
1050061390 9:1713240-1713262 TTTCCTTTTTTAATTTCTTTGGG + Intergenic
1050276036 9:4001649-4001671 TTTAATTTCTAAGTAGCTTCAGG + Intronic
1050520966 9:6499339-6499361 TTTAGTAATTTAGTTGCTTTAGG + Intronic
1050600986 9:7250578-7250600 TTTTTTTTCTTAGTTTCTCTGGG + Intergenic
1050687053 9:8183616-8183638 TTTACTTTCTTAGTCTGTTTAGG + Intergenic
1050809084 9:9720439-9720461 TTTACATTCTTATTTACTTAAGG + Intronic
1050898042 9:10909201-10909223 TTCTCTTTCTTGCTTGCTTTAGG - Intergenic
1050924037 9:11241103-11241125 TTTCCTTTGTTAGGTGCTCTGGG + Intergenic
1051123661 9:13779271-13779293 TTTGTTTTCTCTGTTGCTTTGGG - Intergenic
1051448650 9:17170383-17170405 TTTTCTTGCTTAATTGCTTTGGG + Intronic
1051520728 9:17984421-17984443 TTTTCTTTACTAGTTTCTTTTGG + Intergenic
1051924970 9:22314113-22314135 TTTGCTTTGTATGTTGCTTTTGG + Intergenic
1052277722 9:26696561-26696583 TTTATTTTCTGGATTGCTTTAGG - Intergenic
1052461052 9:28763615-28763637 TTTCTTTTTTTAGTTCCTTTAGG - Intergenic
1052495272 9:29215841-29215863 ATTCCTTTCTTGGTTGCTGTTGG + Intergenic
1052714296 9:32097093-32097115 TTAACATTCTTAGTTTATTTTGG - Intergenic
1052949898 9:34200016-34200038 TATACTTTCTTAGTTTCTTCTGG + Intronic
1053378617 9:37629827-37629849 CTTACTGTCTTAGTTTTTTTGGG + Intronic
1053440349 9:38111132-38111154 TTTACTTTTTTTTTTTCTTTTGG + Intergenic
1054859592 9:69935680-69935702 TTTATTTTAATAGTTGCTCTAGG - Intergenic
1054966992 9:71040463-71040485 TTTACTTTCAGAGTGGCATTTGG + Intronic
1055377999 9:75671344-75671366 TTTATTTTCTTCTATGCTTTTGG + Intergenic
1055789673 9:79910311-79910333 TTTAATTTTTTATTTGCTCTCGG - Intergenic
1056131196 9:83588374-83588396 TTTGCTTTTTTAGTTGCGTGTGG - Intergenic
1056360730 9:85855050-85855072 TTTCCTTTCTTATTTATTTTTGG - Intergenic
1056371522 9:85959408-85959430 TTTTCTTTCTAAGTAGTTTTGGG + Intronic
1057393913 9:94662541-94662563 GTTACATTCTTGGTTGTTTTTGG + Intergenic
1057671233 9:97090643-97090665 TAAATTTTCTTAGTTGATTTGGG + Intergenic
1058327224 9:103713914-103713936 TTTACTTTCTTACTGGCTATTGG - Intergenic
1058773510 9:108262208-108262230 TTTAATATGTTAGTTTCTTTAGG + Intergenic
1059013770 9:110492547-110492569 TTTCCATTCTTAGGAGCTTTAGG - Intronic
1059047837 9:110889957-110889979 TTTAATTTCTTTTTTGCTTTTGG - Intronic
1059183058 9:112238394-112238416 TTTTCTTTCTGAGCTGCATTTGG - Intronic
1059940195 9:119351570-119351592 TTTGCATTGTTAGGTGCTTTGGG - Intronic
1061608540 9:131730234-131730256 ATTAGTTTCTTTGTTGTTTTGGG - Intronic
1061815809 9:133194822-133194844 ATTATTTTCTTAATTCCTTTTGG - Intergenic
1185712046 X:2312336-2312358 TTTTCTTTATTAGTTGCTCTAGG - Intronic
1186942833 X:14529445-14529467 TTTCCTTTTTCAGTTGCTTGGGG - Intronic
1187103169 X:16215849-16215871 TTTCCTTTCTTGGTTCCTATAGG - Intergenic
1187537010 X:20150862-20150884 TATACTTTGCTAGTTGCTCTGGG + Exonic
1187641049 X:21290219-21290241 TTTGTTTTTTTAGTTCCTTTAGG + Intergenic
1188032084 X:25275417-25275439 TTTTCTTTCTTTCTTTCTTTTGG - Intergenic
1188425140 X:30037555-30037577 TTTACTATCGTAATTGTTTTGGG + Intergenic
1188434205 X:30141848-30141870 TTTACTTACTTGGAAGCTTTTGG + Intergenic
1188594102 X:31875653-31875675 TTTACTTTATCAGTTGCAGTTGG - Intronic
1188758198 X:33990608-33990630 TTTATTTTCTTGGCTGCTTCAGG - Intergenic
1188848665 X:35104927-35104949 CTTACTTTCCTAGTTCCTCTGGG - Intergenic
1189682680 X:43533350-43533372 TTTACCTACTGAGTGGCTTTGGG - Intergenic
1190019511 X:46861130-46861152 TTTAACTTCTTAGCAGCTTTTGG + Intronic
1190749980 X:53353642-53353664 TTTATTTTTTTAGCTGTTTTAGG - Intergenic
1190755912 X:53401921-53401943 TTTACTTTTTTCATTGCATTGGG + Intronic
1191601203 X:63010524-63010546 GTTACTTCCTTATTTTCTTTAGG + Intergenic
1192683077 X:73273595-73273617 TTTACTTTTGCACTTGCTTTTGG - Intergenic
1193506706 X:82352638-82352660 CTTACTTTCCTAGTTCCTTGAGG - Intergenic
1193556694 X:82961940-82961962 TTTACTTACTGAGTTGATTCAGG - Intergenic
1193579772 X:83250620-83250642 TTTAATTTCTAAGTTGTGTTTGG + Intergenic
1193605791 X:83566633-83566655 TTTCCTTGCTTATTTGCATTAGG + Intergenic
1193797491 X:85893846-85893868 TTTACTTTCTTAGTCCATTTGGG - Intronic
1193845978 X:86470893-86470915 TTTAGTTTATTATTTGGTTTAGG - Intronic
1193944514 X:87717903-87717925 TTTACATTTTTAATTTCTTTAGG + Intergenic
1194013384 X:88588854-88588876 TTTAATTTATAAATTGCTTTGGG - Intergenic
1194057119 X:89149525-89149547 TCTAGTATCTTAGTTTCTTTTGG - Intergenic
1194199389 X:90936105-90936127 TTTACTTTTAAAGTTGATTTGGG + Intergenic
1194883862 X:99288346-99288368 TTTACTTTTGTGGTTACTTTGGG + Intergenic
1195151601 X:102076407-102076429 TTTAATCTCTAAATTGCTTTGGG - Intergenic
1195160901 X:102170101-102170123 TTTACTTTATAAATTGCTTTGGG + Intergenic
1195236800 X:102907925-102907947 TTTCCTTTTTTAGTTCCTTGAGG - Intergenic
1195479107 X:105322339-105322361 TTTATTTTCCCAGTTTCTTTAGG + Intronic
1195628396 X:107028500-107028522 GTTACTATCTTAGTTGTTTTGGG - Intergenic
1196369960 X:114966472-114966494 GTTCCTTTCTTAGTGTCTTTGGG - Intergenic
1196374161 X:115013333-115013355 CTTAATTTCTTAATTGTTTTAGG - Intronic
1196943655 X:120802443-120802465 TTTTCTTTCTTATTTGCTTCCGG - Intergenic
1197078597 X:122383763-122383785 TTTTCTTTCTTTCTTGTTTTTGG + Intergenic
1197235866 X:124062057-124062079 TATACTTTTTTAGTTGCTGCAGG + Intronic
1197441054 X:126491429-126491451 TTCACTTTCTGGGTTGATTTTGG - Intergenic
1197539958 X:127746296-127746318 TTTACTTTTTTTGTTGATATGGG - Intergenic
1197857012 X:130924659-130924681 TTGACTTTCTTCCATGCTTTAGG + Intergenic
1197983552 X:132243924-132243946 TTTACCCTCTTAGTTTCTTTTGG - Intergenic
1198282835 X:135159087-135159109 TTTACTGTCTCAGTTGCAGTTGG - Intronic
1198714860 X:139546593-139546615 TTTAATTGTTTAGATGCTTTGGG - Intronic
1199006520 X:142704869-142704891 TTTAATTTTTTAGTTTCTGTGGG - Intergenic
1199164918 X:144660366-144660388 TTTATTTTATTATTTGCTGTAGG - Intergenic
1199354986 X:146851645-146851667 TTTACTGGCTTTGTGGCTTTAGG + Intergenic
1200364458 X:155646786-155646808 TTTTCTTGCTTAATTGCTCTGGG + Intronic
1200380415 X:155831328-155831350 TTTTTTGTCTTAGTTTCTTTAGG - Intergenic
1200416255 Y:2914322-2914344 CTTACTTTCCTAGTTCCTTGAGG - Intronic
1200545381 Y:4512524-4512546 TTTACTTTTAAAGTTGATTTGGG + Intergenic
1201240334 Y:11952589-11952611 TGTGGTTTCTTAGTTGCTTCAGG + Intergenic
1202041284 Y:20686667-20686689 TTGGCTTTCTTAGTTTCTTAAGG + Intergenic
1202119207 Y:21507128-21507150 TTTCATTTTTTAGTTGTTTTGGG - Intergenic
1202121659 Y:21530668-21530690 TTTCATTTTTTAGTTGTTTTGGG - Intronic
1202157346 Y:21898714-21898736 TTTCATTTTTTAGTTGTTTTGGG + Intronic
1202159793 Y:21922255-21922277 TTTCATTTTTTAGTTGTTTTGGG + Intergenic