ID: 1159790392

View in Genome Browser
Species Human (GRCh38)
Location 18:72772155-72772177
Sequence AGTTCTCTGTATAATATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159790386_1159790392 27 Left 1159790386 18:72772105-72772127 CCTGAGGACATTCTCAGCTTCTA 0: 1
1: 0
2: 8
3: 32
4: 253
Right 1159790392 18:72772155-72772177 AGTTCTCTGTATAATATGGCAGG 0: 1
1: 0
2: 2
3: 17
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159790392 Original CRISPR AGTTCTCTGTATAATATGGC AGG Intronic
901742982 1:11354493-11354515 AGGTCTCTGTTTAGTTTGGCAGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905909718 1:41645450-41645472 AGTTCCCAGTAAAATATGGAAGG - Intronic
907265818 1:53260262-53260284 AGTTCTTTGTGAAATAAGGCTGG - Intronic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
909427625 1:75545526-75545548 ATTTCTCAGTATAACATGTCAGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912218182 1:107640843-107640865 AGTTATGTGTTTAATATGGGAGG + Intronic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912661440 1:111534654-111534676 AGGTCTATGTATAACCTGGCAGG + Intronic
912765590 1:112407100-112407122 AATGCTGTCTATAATATGGCTGG + Intronic
913961857 1:143345295-143345317 AGTTCCTTGTATAAAATGACTGG + Intergenic
914056212 1:144170869-144170891 AGTTCCTTGTATAAAATGACTGG + Intergenic
914122934 1:144795493-144795515 AGTTCCTTGTATAAAATGACTGG - Intergenic
915701362 1:157799944-157799966 AGTTCTGGGTATAATAAAGCCGG + Intronic
916995614 1:170295717-170295739 AGTTTTCAGTATCATATGTCAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
922372593 1:224926227-224926249 AGTTCACAGTATGATTTGGCTGG - Intronic
924381336 1:243467794-243467816 AGTGTTCTTTATAAGATGGCAGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068589971 10:58843486-58843508 AGAGCTCTGTATAAAATGTCTGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071698934 10:87908419-87908441 AGTTCTTTGTATACTCTGGCTGG + Intronic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1075849816 10:125577686-125577708 AATTGTCTATACAATATGGCAGG - Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1079584651 11:22110900-22110922 ATTACTCTATATAATATGGGTGG + Intergenic
1080762494 11:35265347-35265369 AATTCTGTGTCTAACATGGCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083446829 11:62713697-62713719 AGTTCTCTGTTTAAAATTGTGGG - Exonic
1088181505 11:107117919-107117941 AGTTCTCTCTAAAATAAGGTTGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089252521 11:117175175-117175197 AGCTCTTTGTATATTATGCCAGG + Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093512128 12:19941929-19941951 AATTCACTGGATAATGTGGCTGG - Intergenic
1093586259 12:20840724-20840746 ATTTCTCTCTGTAATATGGTAGG + Intronic
1093611183 12:21160084-21160106 AGTTCTGTGAAGAATATTGCTGG - Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099005128 12:77226606-77226628 AGTTCTCTGCATCATGTGGTTGG - Intergenic
1099060518 12:77902292-77902314 AGTTCTTTCTATGAAATGGCTGG - Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101866089 12:108520620-108520642 AGTGCTCTATGTAATATGGCCGG + Exonic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1106020429 13:25909623-25909645 AGTTCCCAGAATAATGTGGCTGG + Intronic
1106511016 13:30412662-30412684 TGTTCTCTGTATATTTTAGCTGG + Intergenic
1106632846 13:31495211-31495233 AGTTTTATATATAATATGGAGGG - Intergenic
1107106681 13:36650736-36650758 TATTCTCTGAATAAAATGGCTGG - Intergenic
1109894862 13:68672846-68672868 AGTTCTTTATACAATATGGTAGG - Intergenic
1110601165 13:77375841-77375863 AATTCTGTGTATAATGTGTCTGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111349671 13:87010850-87010872 ATCTCTCTGCATAATATGGATGG + Intergenic
1111695367 13:91616817-91616839 ATTTCTCTGTATATTATGTTGGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1123895558 15:24826169-24826191 ATGTCTCTGTAGAAAATGGCTGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127490519 15:59458169-59458191 ACTTCTCTGTAGAATTTTGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138541134 16:57688550-57688572 CCTTCTCTGTACAATGTGGCTGG + Exonic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142845470 17:2671901-2671923 GGTTCTCTGTTTAAAATGGTGGG - Intronic
1143228839 17:5333541-5333563 AGTGCTCTTTATAAAAAGGCAGG + Intronic
1144602887 17:16634214-16634236 ACATCACTGTACAATATGGCAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146464991 17:33079417-33079439 AGGGCTCTGTTTAATGTGGCTGG + Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148069527 17:44899863-44899885 AGTTCTATGTATTAAATGCCTGG + Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153131278 18:1857740-1857762 GGTTATCTGTAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153797304 18:8635852-8635874 GTTTCTCTGTATAAAATGTCAGG - Intronic
1153840904 18:9006952-9006974 AGTTCTTTGTAGATTCTGGCTGG - Intergenic
1153994324 18:10426560-10426582 AATTCTCTCTATAAGATAGCTGG + Intergenic
1154005053 18:10520371-10520393 ACTTCTCAGTATAATATGCTTGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156235127 18:35195865-35195887 TTTTCTTTGTATAATTTGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1158393297 18:57060968-57060990 ATTTCTCTGTACAAGCTGGCTGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159790392 18:72772155-72772177 AGTTCTCTGTATAATATGGCAGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165971119 19:39630813-39630835 AGTTTCTTGTATAAAATGGCTGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202695695 1_KI270712v1_random:123552-123574 AGTTCCTTGTATAAAATGACTGG + Intergenic
925317161 2:2935435-2935457 AGTTCTCAGTTTAACAGGGCAGG - Intergenic
926384300 2:12321071-12321093 AGTTCTCTGTTTCACTTGGCCGG - Intergenic
926505867 2:13714992-13715014 AGTGTTCTGAATAATTTGGCTGG - Intergenic
927407030 2:22782331-22782353 TGTTCTCTGTATTTTATGGGTGG - Intergenic
928695908 2:33849838-33849860 AGTTCTCTGTACAATAGCCCTGG + Intergenic
930907233 2:56586002-56586024 ATTTCTCTGAAGAATATGGATGG - Intergenic
934276858 2:91580593-91580615 AGTTCCTTGTATAAAATGACTGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935825497 2:106944594-106944616 AGTACTCTGGATACTATGTCTGG + Intergenic
938315133 2:130319624-130319646 AGTTCTGTGCATGATGTGGCTGG - Intergenic
938751718 2:134337620-134337642 AATGCTCTGGATAATATAGCTGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939592329 2:144081381-144081403 AGTTAACTGTATGATTTGGCAGG + Intronic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941195621 2:162448006-162448028 TGTTCTCTCTATAAACTGGCTGG - Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942533904 2:176942676-176942698 ATTTCTCTTTCTAATATGTCTGG - Intergenic
942999543 2:182308093-182308115 ATTACTCTTTTTAATATGGCAGG + Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945158441 2:206863825-206863847 AATTCTCTGGAACATATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
945790232 2:214295273-214295295 AGTTCGCTGTATAACAAAGCAGG - Intronic
945907782 2:215614420-215614442 AGTTCTGTGTTTATAATGGCAGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948043608 2:234925600-234925622 AGATTTCTTTACAATATGGCGGG + Intergenic
1175015087 20:55781411-55781433 ATTTCTCTGTTTAATGTTGCTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177305853 21:19315370-19315392 AGTTCTAAGTTTAATATGGGGGG - Intergenic
1177337768 21:19755150-19755172 TGTTCACTGTTTAATATGCCTGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177914054 21:27066083-27066105 AGTACTCTGTTGAATATGACTGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178500986 21:33125302-33125324 TGTTCTGTGGATAATATAGCTGG - Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949345703 3:3074685-3074707 AGTTTTCTATATTATAAGGCAGG - Intronic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
950937302 3:16852287-16852309 AATTTTTTGTAAAATATGGCAGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951195438 3:19818577-19818599 AGTTCCCTGTATAAATTGGTTGG + Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
953138048 3:40200673-40200695 AGTTCTCTATTCCATATGGCAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955901644 3:63762414-63762436 AGTTCTCTGTTTAGTATTACAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957151965 3:76497696-76497718 AGTACTCTCTATAATATGGGTGG + Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957510171 3:81177804-81177826 AGTTTTCTGTAGAATTTGGGTGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959878668 3:111417428-111417450 AGTTCACTGGGTAAGATGGCTGG - Intronic
963588166 3:147221284-147221306 AGTTGTCTTCATAATAAGGCTGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965528658 3:169748486-169748508 GGTTCTGTGTATAATAAAGCAGG - Intergenic
966001829 3:174958224-174958246 AATTATATATATAATATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
969033900 4:4235787-4235809 AGTTCCTTGTATAAAATGACTGG - Exonic
969632726 4:8347773-8347795 GGTTCTCTGTAGCACATGGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975795617 4:78003771-78003793 AGTTTCTTGTATAAAATGGCTGG + Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978583132 4:110252162-110252184 AGTTCTTTGTGTAAAATGGAAGG + Intergenic
978644249 4:110910097-110910119 TGTTCTCTGAAAAATATGGCAGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980552024 4:134350483-134350505 TGGTCTATGTATAATTTGGCAGG + Intergenic
980734977 4:136872888-136872910 AGTTTTTTGTTTATTATGGCTGG - Intergenic
980771459 4:137378740-137378762 ATTTCTCTGCACAATGTGGCAGG - Intergenic
982082788 4:151806832-151806854 AATTCTCTGTGTAAAATGCCTGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984286065 4:177729935-177729957 AATTATCTGTGTAATTTGGCTGG - Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989176891 5:38536656-38536678 AGTTCTCTTTATGAAATAGCTGG - Intronic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990054463 5:51554340-51554362 ATTACTCTCCATAATATGGCGGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1000795704 5:165661812-165661834 ATTTCCCTGGATAGTATGGCTGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003192227 6:3884435-3884457 AGGTCTCTGTAGCACATGGCTGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005657441 6:27955752-27955774 AGTTCTCAGTATAAAATGGCAGG - Intergenic
1005795476 6:29356489-29356511 AGTTCTCTGTTAATAATGGCTGG + Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006532810 6:34671501-34671523 AGTTATCTGTATAATATATGTGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008978852 6:57459767-57459789 AGTACCCTGGATAACATGGCTGG - Intronic
1009166987 6:60352756-60352778 AGTACCCTGGATAACATGGCTGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012274150 6:97251775-97251797 AGTTCTCTGTATGAAATGGAAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015186071 6:130417531-130417553 AATTCTTTGTATTATATGGAAGG + Intronic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018263979 6:162000528-162000550 AGTTCTTTGTATATTTTGGATGG + Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1020839222 7:13194473-13194495 AGTTTTCTGTAGAATGTTGCTGG + Intergenic
1023534320 7:41192404-41192426 AGTTCTCTGTAAAATGAGACAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024101238 7:46034975-46034997 AATTCTCTGTTTATTATGGAGGG + Intergenic
1024656658 7:51456602-51456624 ATTTATCAGTATAATAAGGCAGG - Intergenic
1026396174 7:69956702-69956724 AGTGCTCTGTAGAGTGTGGCAGG + Intronic
1027359740 7:77395567-77395589 TGTTCTCAGTATATCATGGCAGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1029310636 7:99660287-99660309 AGATCTTTGTACAATATTGCTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030578863 7:111326783-111326805 AGTTCTTTTTATAATTTGGGTGG - Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032884642 7:136124476-136124498 AGATCTCTGTATAAGAGGGGAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1040632150 8:49227047-49227069 AGTTGTCTGTCTGAAATGGCAGG + Intergenic
1041472086 8:58222115-58222137 ATTTCTCTGAATAATTTGTCAGG - Intergenic
1041724459 8:61005078-61005100 AGTTTTCTAAATAATAAGGCTGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044018651 8:87076790-87076812 AGCTCTCTGTGTCATATGTCAGG + Intronic
1044079072 8:87861647-87861669 ATTACCCTGCATAATATGGCTGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044494980 8:92866673-92866695 AGTTCTCTGACTACTTTGGCAGG - Intergenic
1045043556 8:98251137-98251159 AGTTATCTATCTAATATGCCTGG + Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046000209 8:108411649-108411671 AGTTCTCTGTTTTAAAAGGCTGG + Intronic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1047425689 8:124743470-124743492 ATTTCTCTTCATAATATGGGTGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050592739 9:7176674-7176696 TGCTCTCTCTATAATATGCCAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052166374 9:25335124-25335146 ATTTCTCTGTTTAAAATGGGGGG - Intergenic
1055285388 9:74723356-74723378 AGTTGTATATATAATATTGCAGG - Exonic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056732204 9:89176440-89176462 ACTACTCTGTTTAATATGACAGG + Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189272863 X:39763903-39763925 GGTTCTCTTTATAATTTGGTTGG + Intergenic
1189467092 X:41285804-41285826 AGTTATCTGTATCTTGTGGCAGG + Intergenic
1191610949 X:63112757-63112779 AGTTCTCTGAATAATATCATTGG - Intergenic
1191642347 X:63440781-63440803 AGTTCTCTGTTTAATATGAGTGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194649419 X:96497840-96497862 AGTTATCTGTAGATAATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic