ID: 1159792535

View in Genome Browser
Species Human (GRCh38)
Location 18:72800381-72800403
Sequence AAACCCTGCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159792535_1159792537 20 Left 1159792535 18:72800381-72800403 CCTATCTTTGTGAAGCAGGGTTT No data
Right 1159792537 18:72800424-72800446 AATGAGATCAGAGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159792535 Original CRISPR AAACCCTGCTTCACAAAGAT AGG (reversed) Intronic